Sequences from confirmation amplicon


Confirmation sequences for line 256E07 and hit At4g32880 are shown.
Line ID 256E07
Locus At4g32880 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:15868131
Primers used for PCR AM04 - 8474, show primer details
   
Sequence Name 11-K026133-022-256-E07C-8409
GenBank Accession LN490952 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K026133-022-256-E07C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCTTGTCTCTTAATTAGGTCT
TTAAAAGGTTCAACGACGGTACAAAAATTTTAACTTTCTTCTGCATATTTATTGGAACCT
AAGAAAGATGCAAAAAAATTCTCTTTAAGGAAAAAGAAAAAGAGGGGAGGATTCTTATAG
ATACCGTAAAAATATTTGTTTTTGATCACGCTGGTCTCTGGAAGCAAAGGAAGATATAGG
AGTTTCTTGCTCTTGCTGTGAATTCTCACAAACCCATCTGAGAAATTTCTTTCTCTATCT
CCAAATCCCTCTTTCTCTCTCAGTGGATGAGTAACTTCCTTCGGAAAAAACGGTGAAGCA
TGCTTCAATGGGAACTACAAGATTCAAACCTCAGACTCTGCTACAGTTCAACC
   
Sequence Name 12-K026133-022-256-E07C-AM04
GenBank Accession LN491411 [GenBank]
Sequencing primer gene specific primer, AM04: 5'-GGAAGAAAGTGGTTGAACTGTAGC-3'
Sequence (A. th genome BLAST matches underlined)
>12-K026133-022-256-E07C-AM04
TCTGAGGTTTGAATCTTGTAGTTCCCATTGAAGCATGCTTCACCGTTTTTTCCGAAGGAA
GTTACTCATCCACTGAGAGAGAAAGAGGGATTTGGAGATAGAGAAAGAAATTTCTCAGAT
GGGTTTGTGAGAATTCACAGCAAGAGCAAGAAACTCCTATATCTTCCTTTGCTTCCAGAG
ACCAGCGTGATCAAAAACAAATATTTTTACGGTATCTATAAGAATCCTCCCCTCTTTTTC
TTTTTCCTTAAAGAGAATTTTTTTGCATCTTTCTTAGGTTCCAATAAATATGCAGAAGAA
AGTTAAAATTTTTGTACCGTCGTTGAACCTTTTAAAGACCTAATTAAGAGACAAGATATA
TTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGG
TCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATG
TCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTC
GTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGT
GTCTACA

Last Updated on 07.07.2016 14:16