Sequences from confirmation amplicon


Confirmation sequences for line 260D11 and hit At1g16780 are shown.
Line ID 260D11
Locus At1g16780 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:5743670
Primers used for PCR FV10 - 8474, show primer details
   
Sequence Name 27-K023623-022-260-D11C-8409
GenBank Accession LN498207 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>27-K023623-022-260-D11C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAAAAGACCCTCCAAAGGTTTACCACAGCATA
ACAAGAGAACTAATCGTAACCCACAAAGTCTGACTATATCTTGATCAGCTTCTTCACACT
TTCTCACTCGGTATTGACTCCGAGAGAAACACCTCCCATATATAGTTTTCAGCATAAGAG
AAGATTCTGAAATAAAACTGACAAGAATTAAGCCCCGGAAAATTTCTCTGTATTAATCGG
ACACCATGAAATTCTACTGTAAGATTTAGCTAGACTTATCGAACACCAACATTTTGTAGA
TAAACCAATCAGATCTAAATTCTCACTATCATGATCTAAACGAAAACGAAAACGTAAACG
ACAGAGAATTAGCGAAATTGTAGGCAAAATAACAGATACGAATAATATTTGTTTCCGAAA
TGCGAGTAAGAAAACCCCTAAATCGGCGAAACAGTGAAGACAAATTACAGTTTCAGAGAA
TGGTCAGAAGAAAACCGCCATCAACTCGAAGCTTGTCGTCCTAGCCGAAGAAGCGTTCTC
CACTCTCTCTGTCTGTTGTCACCGTAAATCCTAACACTTCAGAGGTTAGTTTACACTCTT
TTGTTAATTTATTTCTCATGCCGGGTTAATTGGACAATCCTGACTAATGAG
   
Sequence Name 28-K023623-022-260-D11C-FV10
GenBank Accession LN498676 [GenBank]
Sequencing primer gene specific primer, FV10: 5'-CGTGTCAAAAACTCATTAGTCAGG-3'
Sequence (A. th genome BLAST matches underlined)
>28-K023623-022-260-D11C-FV10
TCCAATTAACCCGGCATGAGAAATAAATTAACAAAAGAGTGTAAACTAACCTCTGAAGTG
TTAGGATTTACGGTGACAACAGACAGAGAGAGTGGAGAACGCTTCTTCGGCTAGGACGAC
AAGCTTCGAGTTGATGGCGGTTTTCTTCTGACCATTCTCTGAAACTGTAATTTGTCTTCA
CTGTTTCGCCGATTTAGGGGTTTTCTTACTCGCATTTCGGAAACAAATATTATTCGTATC
TGTTATTTTGCCTACAATTTCGCTAATTCTCTGTCGTTTACGTTTTCGTTTTCGTTTAGA
TCATGATAGTGAGAATTTAGATCTGATTGGTTTATCTACAAAATGTTGGTGTTCGATAAG
TCTAGCTAAATCTTACAGTAGAATTTCATGGTGTCCGATTAATACAGAGAAATTTTCCGG
GGCTTA

Last Updated on 07.07.2016 14:16