Sequences from confirmation amplicon


Confirmation sequences for line 273H07 and hit At2g19480 are shown.
Line ID 273H07
Locus At2g19480 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:8440130
Primers used for PCR TY03 - 8474, show primer details
   
Sequence Name 05-K026236-022-273-H07C-8409
GenBank Accession LN488203 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K026236-022-273-H07C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGATATTGAAGCCATTTTCATGTAGAATA
AGTCTTTATTGACTGTCGTTTACTGCTGTTCAGGACGGAGATTGAGTGGTATCCTGGAAA
GTGTTTGACACAGAAGATTCTAAAAAAGAAGCCAAAGAAAGGATCCAAAAACACAAAGCC
GATCACTAAGACTGAGGACTGTGAGAGTTTCTTCAACTTTTTCAGTCCACCTCAAGTTCC
TGACGATGATGAGGATCTTGATGATGACATGGTATTTCCATCTCCATAAGCAGTTTAGTT
TTTAGAGTCAGTAATTAAGATTGTGTTGGATTTTAATCTGATCATCTAATATTCACAGGC
TGATGAACTCCAAGGACAAATGGAGCATGATTATGATATCGGGTGTGTACCTTTCTATTT
CATATTCAGTTCTCTTCACTTAGTTCAGTTCTAGGATCTGAGTCTGTCCACTGTTTATCC
TGTAGTTCAACAATCAAAGAGA
   
Sequence Name 06-K026236-022-273-H07C-TY03
GenBank Accession LN488653 [GenBank]
Sequencing primer gene specific primer, TY03: 5'-ATGCGAGATGATTTTCTCTTTGAT-3'
Sequence (A. th genome BLAST matches underlined)
>06-K026236-022-273-H07C-TY03
GAACTACAGGAATAAACAGTGGACAGACTCAGATCCTAGAACTGAACTAAGTGAAGAGAA
CTGAATATGAAATAGAAAGGTACACACCCGATATCATAATCATGCTCCATTTGTCCTTGG
AGTTCATCAGCCTGTGAATATTAGATGATCAGATTAAAATCCAACACAATCTTAATTACT
GACTCTAAAAACTAAACTGCTTATGGAGATGGAAATACCATGTCATCATCAAGATCCTCA
TCATCGTCAGGAACTTGAGGTGGACTGAAAAAGTTGAAGAAACTCTCACAGTCCTCAGTC
TTAGTGATCGGCTTTGTGTTTTTGGATCCTTTCTTTGGCTTCTTTTTTAGAATCTTCTGT
GTCAAACACTTTCCAGGATACCACTCAATCTCCGTCCTGAACAGCAGTAAACGACAGTCA
ATAAAGACTTATTCTACATGAAAATGGCTTCAATATCAATTGTAAATGGCTTCATGTCCG
GGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAA
TTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAG
TACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACA
AATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTAC

Last Updated on 23.10.2014 13:25