Sequences from confirmation amplicon


Confirmation sequences for line 277E09 and hit At1g07150 are shown.
Line ID 277E09
Locus At1g07150 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:2194607
Primers used for PCR DL76 - 8474, show primer details
   
Sequence Name 40-K018602-022-277-E09C-DL76
GenBank Accession LN503549 [GenBank]
Sequencing primer gene specific primer, DL76: 5'-CTCTCAGTGTCACAACTCATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>40-K018602-022-277-E09C-DL76
TGCGTACTTGACTGGGTCAACTCGGGGTTTGACTTAGAAGAAGAAGAAGAGGAAGTAGGG
AGATCAGAATTCGAAGACGCGGCGAAGGCAATAATTTGTAATTTGGCGACGACCGGAGGA
GTAATTTGGGAGTCAGATGGTTGGGTGGAAGTTAGATGCCACGCTTCGGAAGAGGAAGGG
ACAACAATGGAATATTCGGGATCCACAAGGGTAGAATCGGAATATAACACATCATCGGAT
CCAAACGATGACGTGGCTGGTGACTCGGCGATAATTGACGTTTCTATGTCTCATAATACA
TGTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAA
TGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCA
AAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAA
TTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCT
TTATTTCGACGTGTCTACATTCACGT
   
Sequence Name 41-K018602-022-277-E09C-8409
GenBank Accession LN503906 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>41-K018602-022-277-E09C-8409
TAGATTTCCGGACATGAAGCCATTTACAATTGAATATATCCTGACATGTATTATGAGACA
TAGAAACGTCAATTATCGCCGAGTCACCAGCCACGTCATCGTTTGGATCCGATGATGTGT
TATATTCCGATTCTACCCTTGTGGATCCCGAATATTCCATTGTTGTCCCTTCCTCTTCCG
AAGCGTGGCATCTAACTTCCACCCAACCATCTGACTCCCAAATTACTCCTCCGGTCGTCG
CCAAATTACAAATTATTGCCTTCGCCGCGTCTTCGAATTCTGATCTCCCTACTTCCTCTT
CTTCTTCTTCTAAGTCAAACCCCGAGTTGACCCAGTCAAGTACGCAACGCGGAGATGACT
CAGTCGGAGATGAGTTGTGACACTGAGA
Primers used for PCR AJ19 - 8474, show primer details
   
Sequence Name 56-K118809-0022-277-E09C-AJ19
GenBank Accession LN509249 [GenBank]
Sequencing primer gene specific primer, AJ19: 5'-TTAAATGCTCCAAAATCCGAATAC-3'
Sequence (A. th genome BLAST matches underlined)
>56-K118809-0022-277-E09C-AJ19
AGTCTCTTTTGGCCTCTTGAGTCTTCCACCAGCTTACGAACCAAAACCATTTGTCGCAAT
ATTTTTTCACATTAAAATACAACTATTTGGCTGTAAACGAGAGTTATCAATATAAGGCAA
TGGCTCGTAATTAAGACACTCGATCTCATCTCACCGCGTAAAAGATAGTTTTGTCCGATC
CGAATCACATGTGCAAACAAACAAAACTTGAGGCTGTGATTAAAAGACAACGTTTCGAGT
TTATTGCTTTGATTATACTGATACAACAAATACATAGTGAGAACAATTTCCCTAAAGATA
CATGTAGTATAAACCATAATTTCCATTAATAAATGTAAAACCACCACAAATTCTGAGAAA
AAGAAACCACTTGAAATGAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGT
AGATGTCCG

Last Updated on 07.07.2016 14:16