Sequences from confirmation amplicon


Confirmation sequences for line 278E09 and hit At4g36220 are shown.
Line ID 278E09
Locus At4g36220 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:17138656
Primers used for PCR MM43 - 8474, show primer details
   
Sequence Name 43-K019986-022-278-E09C-MM43
GenBank Accession LN504686 [GenBank]
Sequencing primer gene specific primer, MM43: 5'-GTTCCTCCAAACATAACGTCCTAA-3'
Sequence (A. th genome BLAST matches underlined)
>43-K019986-022-278-E09C-MM43
TCAAATAAAAAAATCAAATTAGAATTAAATATAACGTCCTAATAAAATCAAATTAGAATT
AAATATATCCACACTAGTCCACTCTTTCTTTTTTCTCTCTCCATTTTTTGTCTCTTCATT
GGTTTCATAATTATTGTAGATCTGAATATTCAATGCTTCTATATATATTAAAAAAAGATC
ATGCTAAAATCTGTTGCTTTCTCTAGTAAAATAGAAAATTACCTTCCTAATTCAAACAAA
AAAACTTAGGAGAAAATAACTGGTCAATGGATAAGTATTATTACGTAACGCATTAAGAAA
CATGACTATGACTAGTGCTTTTTGAAATATAATTACCATGATGATTGCTTTGATATTGTC
ACGGGTAAGTTTGATGGAATTTTGAAGATCCGCTGTCTCACTGACTAATTTGGCCTCTTC
ACTGTAAAAAGCAAGAAGATCATATGGTAAATGGCTTCATGTCCGGGAAATCTACATGGA
TCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTT
CAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAA
CGACAAATT
   
Sequence Name 44-K019986-022-278-E09C-8409
GenBank Accession LN505037 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>44-K019986-022-278-E09C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACCATATGATCTTCTTGCTTTTTACAGTGA
AGAGGCCAAATTAGTCAGTGAGACAGCGGATCTTCAAAATTCCATCAAACTTACCCGTGA
CAATATCAAAGCAATCATCATGGTAATTATATTTCAAAAAGCACTAGTCATAGTCATGTT
TCTTAATGCGTTACGTAATAATACTTATCCATTGACCAGTTATTTTCTCCTAAGTTTTTT
TGTTTGAATTAGGAAGGTAATTTTCTATTTTACTAGAGAAAGCAACAGATTTTAGCATGA
TCTTTTTTTAATATATATAGAAGCATTGAATATTCAGATCTACAATAATTATGAAACCAA
TGAAGAGACAAAAAATGGAGAGAGAAAAAAGAAAGAGTGGACTAGTGTGGATATATTTAA
TTCTAATTTGATTTTATTAGGACGTTATATTTAATTCTAATTTGATTTTTTTATTTGATT
TTATTAGGACGTTATGTT

Last Updated on 23.10.2014 13:25