Sequences from confirmation amplicon


Confirmation sequences for line 280A02 and hit At1g77950 are shown.
Line ID 280A02
Locus At1g77950 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:29307519
Primers used for PCR TM04 - 8474, show primer details
   
Sequence Name 51-K021167-022-280-A02C-8409
GenBank Accession LN507365 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>51-K021167-022-280-A02C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATAATCATTCAGTATCCAAAGGAT
TTTAGTATATAAAAGTTGCAGAACATTTCAAAAATAGTAAGAGTTTCAGGATTTCTTATG
TAAATAGAAAAAATCGCTGCTGCGCTTTTCTATAAATAACAACAGAGTTCGGGGTTATTT
AGTAAATAGTAAAGGTATCGGATGTTTTCGGTAAATAGAGAAAGTTCCGAAATACTTTGT
AAATAGCCCCGGAACTTAAAAAATAAAGAAACAGTCCGCAAACAATCTTTAATTTTTGTT
GTCAATTTGTTACAAAATAAACAAAAAAAAATCATTAGAAAACACCACAAAATCAAGTGT
TATATTAGCTTTCCAGTCGATTTAACATATAAAATTTCCACTTGTTAAACATTTTGAAGG
ATTTTTTGATAAATTTTCACCATTTGCTATTACAATAGTATATTATTTGTTATTCCGACA
TGGCCATGCTCTGCTCTCTAGTCGATCAAGTTCGTACTATATGTGGCACTCCAAAACGAA
ACACGTCGTGTTTCAGTGACATCGGTACATGCAATGACTCAGTGTGAGGCCCATCA
   
Sequence Name 55-K021167-022-280-A02C-TM04
GenBank Accession LN508671 [GenBank]
Sequencing primer gene specific primer, TM04: 5'-TGATAAGTTTTATTTGATGGGCCT-3'
Sequence (A. th genome BLAST matches underlined)
>55-K021167-022-280-A02C-TM04
CTCATTGCATGTACCGATGTCACTGAAACACGACGTGTTTCGTTTTGGAGTGCCACATAT
AGTACGAACTTGATCGACTAGAGAGCAGAGCATGGCCATGTCGGAATAACAAATAATATA
CTATTGTAATAGCAAATGGTGAAAATTTATCAAAAAATCCTTCAAAATGTTTAACAAGTG
GAAATTTTATATGTTAAATCGACTGGAAAGCTAATATAACACTTGATTTTGTGGTGTTTT
CTAATGATTTTTTTTTGTTTATTTTGTAACAAATTGACAACAAAAATTAAAGATTGTTTG
CGGACTGTTTCTTTATTTTTTAAGTTCCGGGGCTATTTACAAAGTATTTCGGAACTTTCT
CTATTTACCGAAAACATCCGATACCTTTACTATTTACTAAATAACCCCGAACTCTGTTGT
TATTTATAGAAAAGCGCAGCAGCGATTTTTTCTATTTACATAAGAAATCCTGAAACTCTT
ACTATTTTTGAAATGTTCTGCAACTTTTATATACTAAAATCCTTTGGATACTGAATGATT
ATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGA
TGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAA

Last Updated on 23.10.2014 13:25