Sequences from confirmation amplicon


Confirmation sequences for line 290D11 and hit At4g18240 are shown.
Line ID 290D11
Locus At4g18240 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:10085882
Primers used for PCR SS02 - 8474, show primer details
   
Sequence Name 40-K021336-022-290-D11C-8409
GenBank Accession LN503561 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>40-K021336-022-290-D11C-8409
CCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCATAAGGGAAA
GAAGAAAACAAACACGCCCTTAGAAAGCAGCTTGGACTTTCTTCAGCGGAGTCAAGACGG
CCTTTGGTAACTTAATGTTTCCGCGAATACTGCGAGAGTCTTGAGCATACAGATTCAGTT
AATTTATTACACATTTATTTTGGTATAGGTTGGTTGCATAACAAGATTAGTACCACAGAA
AGGAGTTCATCTAATCAGACATGCCATATACAGAACATTAGAGTTAGGTGGACAATTTGT
ACTTCTTGGTTCTAGCCCGGTTCCACATATTCAGGTAACATCCCGGTCCCTTAGATGCTC
TTGATTTCTTCTATTTAATCTCCAGTTTCGTGGTTTTGAGCTTTGAGGCATTTTGTTTTT
TTGTAGAGGGAATTTGAAGG
   
Sequence Name 41-K021336-022-290-D11C-SS02
GenBank Accession LN503920 [GenBank]
Sequencing primer gene specific primer, SS02: 5'-GTTGTTCAATACCTTCAAATTCCC-3'
Sequence (A. th genome BLAST matches underlined)
>41-K021336-022-290-D11C-SS02
CAAAAAAACAAAATGCCTCAAAGCTCAAAACCACGAAACTGGAGATTAAATAGAAGAAAT
CAAGAGCATCTAAGGGACCGGGATGTTACCTGAATATGTGGAACCGGGCTAGAACCAAGA
AGTACAAATTGTCCACCTAACTCTAATGTTCTGTATATGGCATGTCTGATTAGATGAACT
CCTTTCTGTGGTACTAATCTTGTTATGCAACCAACCTATACCAAAATAAATGTGTAATAA
ATTAACTGAATCTGTATGCTCAAGACTCTCGCAGTATTCGCGGAAACATTAAGTTACCAA
AGGCCGTCTTGACTCCGCTGAAGAAAGTCCAAGCTGCTTTCTAAGGGCGTGTTTGTTTTC
TTCTTTCCCTTATGCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACA
TGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTT
TTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGAT
AAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAA
TTCGGAAATCTTTATTTCGACGTGTCTAC
Primers used for PCR 50xd - 3144, show primer details
   
Sequence Name 26-K118953-0022-290-D11C-50xd
GenBank Accession LN498149 [GenBank]
Sequencing primer gene specific primer, 50xd: 5'-GTTTGATTTATTTCACTGCAGGCT-3'
Sequence (A. th genome BLAST matches underlined)
>26-K118953-0022-290-D11C-50xd
CCAAGCAAATTCTTCTGGAGAGGACAGTTTTATGGAGAGCAAGATGATTTCAGACGCTTC
TCGTATTTTAGCCGAGCTGCACTAGAGTTGCTTCTTCAGTCCGGCAAAAAACCCGACATC
ATACATTGTCATGACTGGCAAACAGCTTTTGTTGTACGGCTTGATCTTATTTTGAAGCAG
TAACGTAATTCATTTTGTTTAGGATACATCTTGAAGCTTTCTTTTTTTTTTTTTTTTTAA
AAGGGCCCCCCTTTTTTGGGATTTTTTTCCCCCAAGGGGATTAATTTCGCAAAAAAAAGG
TTTTACTTGTCAAAATTTGGAGTATAAGGGCCCCCCTCCCCCTCCAAAATGGGGATTTGG
GGGGTTTGATTTTACCCTTTTAAATAACCCAAACAAAAGCCGGGACCCCCCTCGGGGAAA
ATCCACCCCCCCCCCA

Last Updated on 07.07.2016 14:16