Sequences from confirmation amplicon


Confirmation sequences for line 291H12 and hit At4g27250 are shown.
Line ID 291H12
Locus At4g27250 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:13644156
Primers used for PCR NB47 - 8474, show primer details
   
Sequence Name 80-K101271-0022-291-H12C-8409
GenBank Accession LN513922 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>80-K101271-0022-291-H12C-8409
GCCATTTCATGAAGACTTCAAGGCAAATTTACAAAACAGTCCAAGTTTTAGCCAAAATAA
CCAATTAACTCATTTTTATTTCAAAGGATTGTGTAAAGTACCTAAAAGATTCGATATAAA
CAAAGTTTGAAAACAAGAAAATACCAAGATCTCTGAGAGTGGCATGGACTGTGTAACCTC
TTTGGAGAAGAGACTTAACCAACCAAGAACCGATGTATCCACTTGCACCCGTCACGCAAT
ACGTCGCCGTTTTGCTTTCCTCTCCTTGCAATTCCATCACTCCCTCTTCTTCTTCTCGAA
ATGCCAAATTTACAGTGTAATTTTGGCTTGTAACGATNAGTTATTAAATTATTTGTCTGT
GCTATTTTAAATATTGTGTTTTGTTTGTTTCCTTTGATACGGTGTCAATATTTTCATATT
TTTTGACAATTGGAAAACTACTAGACAGACAACTTTTTATCTTTTTGACATATTATTATA
TTTGGTAAGCTTTGATTTTTGGCGATTTAGTGTAATACAATCATAGTGCAACATCATTCA
TTAAGACGGGAAGAGGAAAAAAAAAACCTCGCATTAGTCATTTCCAGCGAAAGGGCTCAG
TGTTGTGTTGGTTTTG
   
Sequence Name 80-K101277-0022-291-H12C-NB47
GenBank Accession LN513923 [GenBank]
Sequencing primer gene specific primer, NB47: 5'-AACAAAACAAACACAACACTGAGC-3'
Sequence (A. th genome BLAST matches underlined)
>80-K101277-0022-291-H12C-NB47
TTTTTTTTTCCTCTTCCCGTCTAATGAATGATGTTGCACTATGATTGTATTACACTAAAT
CGCCAAAAATCAAAGCTTACCAAATATAATAATATGTCAAAAAGATAAAAAGTTGTCTGT
CTAGTAGTTTTCCAATTGTCAAAAAATATGAAAATATTGACACCGTATCAAAGGAAACAA
ACAAAACACAATATTTAAAATAGCACAGACAAATAATTTAATAACTTATCGTTACAAGCC
AAAATTACACTGTAAATTTGGCATTTCAAGAAAAAAAAAAGGGAGTGATGGAATTGCAAG
GAAAGGAAAGCAAAACGGCAACTTATTGCGTGACGGGTGCAAGTGGATACATCGGTTCTG
GGTTGGTTAAGTCTCTTCTCCAAAGAGGTTACACAGTCCATGCCACTCTCAAAGATCTGG
GTATTTTCTTGTTTTCAAACTTTGTTTATATCGAATCTTTTAGGTACTTTACACAATCCT
TTGAAATAAAAATGAGTTAATTGGTTATTTTGGCTAAAACTTGGACGGTTTTGTAAATTT
GCCTTTGAAGTCTTCATGTAAATGGCTTCATGTCCGGGAAATCTACTTGGATCAGCAATG
AGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAA
AATGTAGATTTCC

Last Updated on 23.10.2014 13:25