Sequences from confirmation amplicon


Confirmation sequences for line 294B05 and hit At2g26510 are shown.
Line ID 294B05
Locus At2g26510 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:11275651
Primers used for PCR RK98 - 8474, show primer details
   
Sequence Name 25-K023619-022-294-B05C-8409
GenBank Accession LN497267 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>25-K023619-022-294-B05C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGATTCTGGCGGATCAT
TACTGTGTGGAAATCGGTCTACCAATGCTGATTCTGTTGATCATCACACAGCAAGTCGGG
CTTTTTATTATTTTCCGCGCTATATATGGTGGTGATTGTTTAGATATGTAATATTAAATC
TTGCTACTGTTCATCTTGCAGTATCTTAAACATGCATTCTCAAGGATTTCTATGATTCTT
GAAAGATATGCTTTACTTGTTTGCCTGGCTATCATATGGGCTTTTGCTGCTATCCTTACT
GTTTCTGGTGCTTATAATAATGTTTCTACCGCAACAAAACAAAGTTGTCGAACTGATCGT
GCCTTTCTTATGTCATCAGCTCCCTGGTAGGTTGATTACTATTTGACTTGATTCTTCTTT
TCTTCTAAGGTCTAAATATCTTTATACTCAGTCACTCAAACTCATCTTTCAGGATTAGAA
TCCCATATCCATTCCAGTGGGGGACTCCGATATTCAAAGCGAGTCATGTTTTTGGAATGT
TTGGTGCTGCAATTGTCGCATCTGCAGAGGTTGTTATTCATCATATTAGTTTCTAGCTTA
TGTTAAATATTCTTCATGTTACATGCTACAACTTGTTCTTATGTTATGTATATCCTTATT
TTCTTTAG
   
Sequence Name 26-K023619-022-294-B05C-RK98
GenBank Accession LN497744 [GenBank]
Sequencing primer gene specific primer, RK98: 5'-GCGAAAAATACTCCGGTAGACTAA-3'
Sequence (A. th genome BLAST matches underlined)
>26-K023619-022-294-B05C-rk98
GAAAATAAGATATACATAACATAAGAACAAGTTGTAGCATGTAACATGAAGAATATTTAA
CATAAGCTAGAAACTAATATGATGAATAACAACCTCTGCAGATGCGACAATTGCAGCACC
AAACATTCCAAAAACATGACTCGCTTTGAATATCGGAGTCCCCCACTGGAATGGATATGG
GATTCTAATCCTGAAAGATGAGTTTGAGTGACTGAGTATAAAGATATTTAGACCTTAGAA
GAAAAGAAGAATCAAGTCAAATAGTAATCAACCTACCAGGGAGCTGATGACATAAGAAAG
GCACGATCAGTTCGACAACTTTGTTTTGTTGCGGTAGAAACATTATTATAAGCACCAGAA
ACAGTAAGGATAGCAGCAAAAGCCCATATGATAGCCAGGCAAACAAGTAAAGCATATCTT
TCAAGAATCATAGAAATCCTTGAGAATGCATGTTTAAGATACTGCAAGATGAACAGTAGC
AAGATTTAATATTACATATCTAAACAATCACCACCATATATAGCGCGGAAAATAATAAAA
AGCCCGACTTGCTGTGTGATGATCAACAGAATCAGCATTGGTAGACCGATTTCCACACAG
TAATGATCCGCCAGAATCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCT
ACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAAT
TTTTTTTCAATTCAAAAATG

Last Updated on 07.07.2016 14:16