Sequences from confirmation amplicon


Confirmation sequences for line 294F07 and hit At3g13870 are shown.
Line ID 294F07
Locus At3g13870 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:4571067
Primers used for PCR PH35 - 8474, show primer details
   
Sequence Name 25-K017512-022-294-F07C-PH35
GenBank Accession LN497229 [GenBank]
Sequencing primer gene specific primer, PH35: 5'-CAAAGTGTCTCTGAACAAAGCAAG-3'
Sequence (A. th genome BLAST matches underlined)
>25-K017512-022-294-F07C-PH35
TGAAATTCAGTCTTCCTATTCAATAACATCTTCAAAATCTAGGCTTTAAATCTTCCCCAC
AAGTTGCATCGAGTGTCTCCTTTAAACCCAGAATCCTTAATTTTTGATTGATTCCTCGCA
TTTTCGAATCACTAAGATAACTGTTAATCCACTAGAAACCTAGCCAAAAAATTTCATTGA
AACCCCAAATTTCAACAACAATTAAGCAAATCGAAACTCGGAATCATCTAATACACTGAT
CTGCTACTAAATAGAAGAAAGAAGAATCAATCACCTACCATCTAATGAGCAAAAGAGACT
ATCAAAATTTTACATCAGACAGATCACAATCCAAATCACAGAGCTTAGAAAGAAACTGAA
ATCGAAAACGAGTAACGCTTGGTCAAAACGAAAACTGATCAGATCAAAGCGAAAAAACGG
ATCCACGAGATCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGG
ATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTT
TCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAA
ACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTC
GGAAATCTTTATTTCGACGTGTCTACAT
   
Sequence Name 29-K017512-022-294-F07C-8409
GenBank Accession LN499080 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>29-K017512-022-294-F07C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGATCTCGTGGATC
CGTTTTTTCGCTTTGATCTGATCAGTTTTCGTTTTGACCAAGCGTTACTCGTTTTCGATT
TCAGTTTCTTTCTAAGCTCTGTGATTTGGATTGTGATCTGTCTGATGTAAAATTTTGATA
GTCTCTTTTGCTCATTAGATGGTAGGTGATTGATTCTTCTTTCTTCTATTTAGTAGCAGA
TCAGTGTATTAGATGATTCCGAGTTTCGATTTGCTTAATTGTTGTTGAAATTTGGGGTTT
CAATGAAATTTTTTGGCTAGGTTTCTAGTGGATTAACAGTTATCTTAGTGATTCGAAAAT
GCGAGGAATCAATCAAAAATTAAGGATTCTGGGTTTAAAGGAGACACTCGATGCAACTTG
TGGGGAAGATTTAAAGCCTAGATTTTGAAGATGTTATTGAATAGGAAGACTGAATTTCAG
ATCTTGCTTTGTTCA

Last Updated on 07.07.2016 14:16