Sequences from confirmation amplicon


Confirmation sequences for line 328G03 and hit At4g31800 are shown.
Line ID 328G03
Locus At4g31800 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:15383601
Primers used for PCR IS33 - 8474, show primer details
   
Sequence Name 35-K018320-022-328-G03C-IS33
GenBank Accession LN501635 [GenBank]
Sequencing primer gene specific primer, IS33: 5'-CAAATTGAGACTACGCACCAACTA-3'
Sequence (A. th genome BLAST matches underlined)
>35-K018320-022-328-G03C-IS33
GGTTTGTATCTCAAGATAAAGGTTTCTTTTATGGACGGTTCTTCGTTTCTCGACATCTCT
CTCGATCTCAACACCAATCCTTTCTCCGCAAAACTTCCGGTAAGTCCGGATTTCGTCTGA
TCCATTTTCCCGAAATCTAAGTTGATTTTTGTATCCCTTCAATTTCTATGAACTGGGATT
TTGGGAATTAATCATGGGTTCATTTCAAATTTTCGTATTTCAGAAGAAGGAGGTCTCAGT
TTTGGCTTCTACTCACTTAAAGAGGAAATGGTTGGAGCAAGACGAGGTTAGTTCTTTCGT
CGAACACTTGGTGTGCACTACCTTCGACTTCATATATTCAATTAAGATATATTCAATTGT
AAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGG
AGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCG
TTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATA
GGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATT
CA
   
Sequence Name 39-K018320-022-328-G03C-8409
GenBank Accession LN503189 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>39-K018320-022-328-G03C-8409
ATGAAGCCATTTACAATTGAATATATCTTAATTGAATATATGAAGTCGAAGGTAGTGCAC
ACCAAGTGTTCGACGAAAGAACTAACCTCGTCTTGCTCCAACCATTTCCTCTTTAAGTGA
GTAGAAGCCAAAACTGAGACCTCCTTCTTCTGAAATACGAAAATTTGAAATGAACCCATG
ATTAATTCCCAAAATCCCAGTTCATAGAAATTGAAGGGATACAAAAATCAACTTAGATTT
CGGGAAAATGGATCAGACGAAATCCGGACTTACCGGAAGTTTTGCGGAGAAAGGATTGGT
GTTGAGATCGAGAGAGATGTCGAGAAACGAAGAACCGTCCATAAAAGAAACCTTTATCTT
AAGATACAAACCAAAGGACTAGTTGGTGCGTAG

Last Updated on 07.07.2016 14:16