Sequences from confirmation amplicon


Confirmation sequences for line 331H06 and hit At5g49770 are shown.
Line ID 331H06
Locus At5g49770 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:20226901
Primers used for PCR DW03 - 8474, show primer details
   
Sequence Name 17-K022565-022-331-H06C-8409
GenBank Accession LN493685 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>17-K022565-022-331-H06C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAGTCTAGTGTAGATGTCTACTCCCTC
TGTAACCGACAGGCTATTGAATCATCACCACACCAAACCCATACACATCGCTCTTCTCCG
TCAATTGATTCGTCATGTAGTACTCAGGATCAAGATAGCCCTAATTAATTCCAGAGATAT
TGTTAGTTTTTATAGTTAATGGTTTCATATATTTTATGATAGATTCTTTTTTACTCACCA
TGGTTCCTTTCACTTGTGTTGTGACATGAGCTTTTTCAGGGTCCCCCACAAGTTTGGAGA
GACCGAAATCAGCAACCTTTGCGGTTAGATGTTCATCAAGTAATATGTTATTTGATTTGA
CGTCTCTATGTATAATTGGAGGATCAGCAAGCTCATGAAGATAAGCTAGACC
   
Sequence Name 18-K022565-022-331-H06C-DW03
GenBank Accession LN494133 [GenBank]
Sequencing primer gene specific primer, DW03: 5'-CTCAGGGAAGGGTCTAGCTTATCT-3'
Sequence (A. th genome BLAST matches underlined)
>18-K022565-022-331-H06C-DW03
CTTGCTGATCCTCCAATTATACATAGAGACGTCAAATCAAATAACATATTACTTGATGAA
CATCTAACCGCAAAGGTTGCTGATTTCGGTCTCTCCAAACTTGTGGGGGACCCTGAAAAA
GCTCATGTCACAACACAAGTGAAAGGAACCATGGTGAGTAAAAAAGAATCTATCATAAAA
TATATGAAACCATTAACTATAAAAACTAACAATATCTCTGGAATTAATTAGGGCTATCTT
GATCCTGAGTACTACATGACGAATCAATTGACGGAGAAGAGCGATGTGTATGGGTTTGGT
GTGGTGATGATTCAATAGCCTGTCGGTTACAGAGGGAGTAGACATCTACACTAGACTCAA
TTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAAT
ATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC
AGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATT
TATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTA
CATT

Last Updated on 07.07.2016 14:16