Sequences from confirmation amplicon


Confirmation sequences for line 332A05 and hit At5g21150 are shown.
Line ID 332A05
Locus At5g21150 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:7197852
Primers used for PCR KD03 - 8474, show primer details
   
Sequence Name 16-K017519-022-332-A05C-KD03
GenBank Accession LN493215 [GenBank]
Sequencing primer gene specific primer, KD03: 5'-AAATTTGGGTTTTACGGTTTTACC-3'
Sequence (A. th genome BLAST matches underlined)
>16-K017519-022-332-A05C-kd03
AATATTCCTGAAGGGTTACTTAACTAACACACCCTGAAGGTTATAAGTACCTAAAGTTGC
AAATTTTCTGGGCAAAATGTTTTCTTTTAAACCTAGCAGATGTTGTAGTTCATCGATATG
TTCCAAATCTAACTATATGATGCAAATCACACTGCCTATATGTAATTCAGCCACAACATC
AGATCGACGTTAAAAAAAGAAGAGAACTCAATGCCTTAAAATACCAAATCTGATTAAGCA
TAATAAAGTATCAACCAACAGCGCCCACAAAAACCGACAGAATATAAAGAGTATCTCCTC
AATGTTAAAGGGTCGACGAAAAACAAAAGAGGAACCAAACCCAGAGAAGAGTAAACAAAA
GTTCGTTGGTTCTCCATCAAAAGCATATAAACTCAGCTATCGTGTGGACTGGACCATGTT
CCATCAACAGAAGAACATGGAGGTTGAAACATTATTGTGCAGCTGCGGCATAGGTGGCAC
AGGGACTGCTCCAGGTGTGGTGATTCCTCCATGGCTCGAAGAAGTCTCAGACAACTCTTC
ATACTTCATCACAGTTCCCATCTGTGCAGCTGCCAAATGAGCGTAACATACAGGTGCAAC
TGCAAACAAACATAAAGAAACTTGAGAATTGAGATATTGCAACATAATGTTGTAGCTATC
AGCAGCAACGCATAAAAGATGTGAGAAAAAGAAAAAGAAATATGGAGAAATCTACATGGA
TCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTT
CAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAA
CGACAAA
   
Sequence Name 17-K017519-022-332-A05C-8409
GenBank Accession LN493658 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>17-K017519-022-332-A05C-8409
CATGTAGATTTCTCCATATTTCTTTTTCTTTTTCTCACATCTTTTATGCGTTGCTGCTGA
TAGCTACAACATTATGTGCAATATCTCAATTCTCAAGTTTCTTTATGTTTGTTTGCAGTT
GCACCTGTATGTTACGCTCATTTGGCAGCTGCACAGATGGGAACTGTGATGAAGTATGAA
GAGTTGTCTGAGACTTCTTCGAGCCATGGAGGAATCACCACACCTGGAGCAGTCCCTGTG
CCACCTATGCCGCAGCTGCACAATAATGTTTCAACCTCCATGTTCTTCTGTTGATGGAAC
ATGGTCCAGTCCACACGATAGCTGAGTTTATATGCTTTTGATGGAGAACCAACGAACTTT
TGTTTACTCTTCTCTGGGTTTGGTTCCTCTTTTGTTTTTCGTCGACCCTTTAACATTGAG
GAGATACTCTTTATATTCTGTCGGTTTTTGTGGGCGCTGTTGGTTGATACTTTATTATGC
TTAATCAGATTTGGTATTTTAAGGCATTGAGTTCTCTTCTTTTTTTAACGTCGATCTGAT
GTTGTGGCTGAATTACATATAGGCAGTGTGATTTGCATCATATAGTTAGATTTGGAACAT
ATCGATGAACTACAACATCTGCTAGGTTTAAAAGAAAACATTTTGCCCAGAAAATTTGCA
ACTTTAGGTACTTATAACCTTCAGGGTGTGTTAGTTAAGTAACCCTTCAGGAATATTGGT
AAAACCG

Last Updated on 07.07.2016 14:16