Sequences from confirmation amplicon


Confirmation sequences for line 333H01 and hit At1g19640 are shown.
Line ID 333H01
Locus At1g19640 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:6790138
Primers used for PCR RS21 - 8474, show primer details
   
Sequence Name 09-K024135-022-333-H01C-RS21
GenBank Accession LN490004 [GenBank]
Sequencing primer gene specific primer, RS21: 5'-TTCACGAAACAGCACCTAAAAATA-3'
Sequence (A. th genome BLAST matches underlined)
>09-K024135-022-333-H01C-RS21
ATATACCTTTTTAGGGCGTGGGAATCTTTCTCATTTGAGAAACCAACATAAAAACAGAAA
CCTAGTGGTCCACATAAGCTTGTCAGTTTATCAAAACTATCACAAATAGACATGCTAAGT
TGCTAACAAGTTGAATTATCATCCATATATTTTTAAGGTTCCATGTCGTGAGGCGGAGAA
GGAAGACAGGACAATAACAGCTGATTTAGAAAACATGGGGAAAATATACATATCAAAGAC
AAGTCCTAAGAGTGCACATAAAGCTTATGCTCTTCAATTCCAAACTGATTTCTGGGTTTT
TTTGAGATCGCGATCTGAGGAGTTGGTCCCGGGAGGCCGAATGGTTTTATCGTTCCTTGG
TAGAAGATCACTGGATCCCACAACCGAAGAGAGTTGCTATCAATGGGAACTCCTAGCTCA
AGCTCTTATGTCCATGGCCAAAGAGGTATAGTGGTGTACATATGTTTACATTTATTTATA
ACTAACATGTAAGTCTCTTTCGGTTATAAATGGCTCATATTCTAAAAGGATCTGACCATG
TCACGTTACTTGACCAATTAAGTCCTAGCTAGTAATGTGTAAATGGCTTCATGTCCGGGA
AATCTACATGGATCAGCAATGAGTATGATGGTCAATATTGGAGAAAAAGAAAGAGTAATT
ACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTA
CATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAA
TTATTCTAATT
   
Sequence Name 10-K024135-022-333-H01C-8409
GenBank Accession LN490478 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>10-K024135-022-333-H01C-8409
TAGATTTCCCGGACATGAAGCCATTTACACATTACTAGCTAGGACTTAATTGGTCAAGTA
ACGTGACATGGTCAGATCCTTTTAGAATATGAGCCATTTATAACCGAAAGAGACTTACAT
GTTAGTTATAAATAAATGTAAACATATGTACACCACTATACCTCTTTGGCCATGGACATA
AGAGCTTGAGCTAGGAGTTCCCATTGATAGCAACTCTCTTCGGTTGTGGGATCCAGTGAT
CTTCTACCAAGGAACGATAAAACCATTCGGCCTCCCGGGACCAACTCCTCAGATCGCGAT
CTCAAAAAAACCCAGAAATCAGTTTGGAATTGAAGAGCATAAGCTTTATGTGCACTCTTA
GGACTTGTCTTTGATATGTATATTTTCCCCATGTTTTCTAAATCAGCTGTTATTGTCCTG
TCTTCCTTCTCCGCCTCACGACATGGAACCTTAAAAATATATGGATGATAATTCAACTTG
TTAGCAACTTAGCATGTCTATTTGTGATAGTTTTGATAAACTGACAAGCTTATGTGGACC
ACTAGGTTTCTGTTTTTATGTTGGTTTCTCAAATGAGAAAGATTCCCACGCACTAAAAGG
TATATCACTTGCGTAATATTTTTAGG
Primers used for PCR 90wr - 8474, show primer details
   
Sequence Name 48-K118576-0022-333-H01C-90wr
GenBank Accession LN506643 [GenBank]
Sequencing primer gene specific primer, 90wr: 5'-TTCACCGAAAGTAGGTTCTAGCAT-3'
Sequence (A. th genome BLAST matches underlined)
>48-K118576-0022-333-H01C-90wr
TCTTCGGCCACTAGCTAGGGCTTCGGGTTTGGACCTTATTACAAGGTCATAACTCTCCTC
ACTGATACTCCCACCTTCCCAATCAATCGGACTTATCTCAAGCCTATCGATCGAAAATGA
CCCTTCTTTCTCTATCACCATTTTCAACTCTTCGGAGCTCGCAGCATAGTAAGGAGCGTT
GAAAGCATCGATCTTCTCTTCCTCGATGATACCCTTAAGATGGAGAAAAATAAACGCGGC
ACCTTTTAGTTATGACTTACTGAGGATTTCTTCTAGGTTTTTTTTTTTTTTTTTTAAACC
AATGGACCCAAAAACCTTCCGTTTTGGGGGGACCAACCCAAAAATTTAACTTTGTTTTGG
ACCAAATTTTTAACCAAAAAAATCTTTGAAAAAAACCAGAAAGGGTTTAAAAGAAAAATC
TGGGCAACAAAATTTGGGGTTCAAAAAATTTTTTTGAAAATTAGGAAAATTCAAATTTTT
TTTTTTCAAAATCCAAAAACTTTTTTAAATTTCCCAAACCTTTTTAACCTTTTTGGAATT
TTGGGGGGGGGAAAAGGTTTTTCCGGCCAACCTTGGTTTTTTTAAAAAAAAAAAAACCGG
GAAACAAATAAAAAAATTTTTTTTTCCAAAAAATTCCTTTTTTTCCCCAAAAATTTATTG
GTTGGGGAAAATTTTTGGAAAAATTTTGCCTGGTTTTGGGCACACCAAAAATTTTCAAGG
GGGAAAAAACAAAACCTTTTGGTATAAAAAAA
   
Sequence Name 40-K118575-0022-333-H01C-8409
GenBank Accession LN503874 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>40-K118575-0022-333-H01C-8409
TTGAAATATCCTAATTTGATCAAATTTCTTTTTCCAATTTCTTGCGGTTTCTCAAATTAC
TTAAGTTAGTCAACAAAGATTTTATCATATACAAATAGATTTGATATATACCATATAGAA
ATTATTTGTAGTGCCAAATACTAGCTAAATTCTTACTATATATTTACGCAATCAATTAAG
TTTTGGAGAAAAAAACGAATACTTATGAAAAAACATATTTATTAATTAGTTCCCGGTTTT
TTCTCTTGATAAAGAAGCAAGGTATGGCAGTAAAACATTTTACCCTCCTCATAATTACAA
AATAGTTAATAATGTTTTGGTAATTTAAACTAGTTTCTTGATTTCTGAAAAAAAAAATCT
TGATTTCTCTATATTTCAACATAACTATTTAGAACTCAATATATTGTAGCCTAGATTTTC
CTCTAAAACCATTCATGATTATTTCAAACGATTTTCTAGATAATATATATGATCAAAACT
AATGTTAAATCTTAGGTTTGATCCAACAAGATCGATAGATTATTGGATCAATAGATTAAA
AAAAAAAAAAAAAAACCCTAAAAAAATCCCCCAGAAGTCCAAAACAAAAGGGGGCCGGTT
TTTTTTTTCCCCTTCTAAGGGGTTCCTCCGGGAAAAAAAAAATCGTTTTTTTAAACCCTC
TTAATTATGTTGGAACTCCCAAAAATTTAAAATGGGTAATAAAAAAAAAGGGGTCTTTTC
CAACCAAAGGGTTGGAAAAAATCCCCATGGTTGGGAAGGGGGGAATT

Last Updated on 07.07.2016 14:16