Sequences from confirmation amplicon


Confirmation sequences for line 339B01 and hit At2g26230 are shown.
Line ID 339B01
Locus At2g26230 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:11167129
Primers used for PCR UF12 - 8474, show primer details
   
Sequence Name 23-K021643-022-339-B01C-8409
GenBank Accession LN496381 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>23-K021643-022-339-B01C-8409
TGACCTCGAACTGTTTGCAGTTACAGTATTATTCTTGCAACAAAAGCCAAAAGTTGACCT
TACACACTTCATTTAAATTGTTATTTCATAAACGAGGCAAACGCCAAAAGTTGCAGAACC
TGTGAAATTGTGTTTGATATTTCCATGTATGATGTATTGTCTTAAAACCTCATAGTTTCG
AGGTTATACGGCTTAGAGTTGCTTCTATAGATCCATGAGGTTCATCGGTTGGCAGGTACA
CATCATCTTTAAACTGCAAATGCAAGTCATTGGAAACGATTCATACCCTGAAATTATTAG
CTTTTATGCGGCTTTTTTGTTGTCTGATTTTAAGTTTATAACTATGTATTACTGCTGCTA
CTTATCTACTTATCATTTTCGTTTA
   
Sequence Name 24-K021643-022-339-B01C-UF12
GenBank Accession LN496823 [GenBank]
Sequencing primer gene specific primer, UF12: 5'-AAACCACAAAACGTAAACGAAAAT-3'
Sequence (A. th genome BLAST matches underlined)
>24-K021643-022-339-B01C-UF12
TAATACATAGTTTAAACTTAAAATCAGACAACAAAAAAGCCGCATAAAAGCTAATAATTT
CAGGGTATGAATCGTTTCCAATGACTTGCATTTGCAGTTTAAAGATGATGTGTACCTGCC
AACCGATGAACCTCATGGATCTATAGAAGCAACTCTAAGCCGTATAACCTCGAAACTATG
AGGTTTTAAGACAATACATCATACATGGAAATATCAAACACAATTTCACAGGTTCTGCAA
CTTTTGGCGTTTGCCTCGTTTATGAAATAACAATTTAAATGAAGTGTGTAAGGTCAACTT
TTGGCTTTTGTTGCAAGAATAATACTGTAACTGCAAACAGTTTCGAGGTCATGTTACATT
TTTACATACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAAT
TACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGT
ACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAA
ATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACA

Last Updated on 23.10.2014 13:25