Sequences from confirmation amplicon


Confirmation sequences for line 340D03 and hit At1g77950 are shown.
Line ID 340D03
Locus At1g77950 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:29308746
Primers used for PCR TM05 - 8474, show primer details
   
Sequence Name 19-K021337-022-340-D03C-8409
GenBank Accession LN494574 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>19-K021337-022-340-D03C-8409
TAGATTTCCCGGACATGAAGCCATATTCGGGTATGACATGAGTCTGAGCCATTTCAGCAT
TTTTTTTTTTCGTGTGTGACAGTATTTGTTAAGGACTTTGGAAAAACTCAAAATTGAGGA
TGACATGGCTCTCCAAATCAACGAACCTCGGTTTATTCCTCATTAATCCTTATAATAAAT
TTGTTTCATCTTGTTTATATGTTTTAAGAAACAAAATCTGCTAGCTAATCTTTACCTCAT
GACACTCTGGTACAGTCCAAAAGCCACCAACTCCAATGTCGAGGTGGTATAAATTTCACA
ATAATTCCTCAATTTTACTAATTTCACAAGGATTTTTCTAATTATATTTAAGTTTTTAAA
GGAACTTGAGCAAGAAGTTTGTAGATTACAACAACAGCTTCAGATATCAAAGGAAGAACT
CAGGTATTTTCCTTCAATTAGTCCTATTTAATCAATACGCTTTTATAATCAATATGTATA
TTTAAGATTATAAAATATACATAGGAAATTCGAACCAGATCCAATGAGGCTAACATCAAT
GGAGGAGATTGAAGCATGTGAAGCTAACCTCATCAATAC
   
Sequence Name 20-K021337-022-340-D03C-TM05
GenBank Accession LN495030 [GenBank]
Sequencing primer gene specific primer, TM05: 5'-CATTGTGTTAATATGCATCACCCT-3'
Sequence (A. th genome BLAST matches underlined)
>20-K021337-022-340-D03C-TM05
TGGACGACACGTGTCAACGTATTGATGAGGTTAGCTTCACATGCTTCAATCTCCTCCATT
GATGTTAGCCTCATTGGATCTGGTTCGAATTTCCTATGTATATTTTATAATCTTAAATAT
ACATATTGATTATAAAAGCGTATTGATTAAATAGGACTAATTGAAGGAAAATACCTGAGT
TCTTCCTCTGATATCTGAAGCTGTTGTTGTAATCTACAAACTTCTTGCTCAAGTTCCTTT
AAAAACTTAAATATAATTAGAAAAATCCTTGTGAAATTAGTAAAATTGAGGAATTATTGT
GAAATTTATACCACCTCGACATTGGAGTTGGTGGCTTCTGGACTGTACCAAAGTGTCATG
AGGTAAAGATTAGCTAGCAAATTTTGTTTCTTAAAACATATAACCAGGATGAACCAAATT
TTTTATAAGGAT

Last Updated on 07.07.2016 14:16