Sequences from confirmation amplicon


Confirmation sequences for line 349D11 and hit At1g14920 are shown.
Line ID 349D11
Locus At1g14920 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:5149347
Primers used for PCR JO02 - 8474, show primer details
   
Sequence Name 01-K026766-022-349-D11C-8409
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K026766-022-349-D11C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCATGTAGAGTAATTGCCGA
TCC
   
Sequence Name 02-K026766-022-349-D11C-JO02
GenBank Accession LN486886 [GenBank]
Sequencing primer gene specific primer, JO02: 5'-GTGAACAGTCTCAGTAGCGAGTTG-3'
Sequence (A. th genome BLAST matches underlined)
>02-K026766-022-349-D11C-JO02
GAAAGATCGTCTTCTTGAACATTAGACATCATAACTTCAAGCTGCTCGAGTTTCTGAGCA
ACATCAGCCATTTCGGATGACCTAACCTTGTAACCAAGAACAGCTAGAAGCTCATCCATG
CCGTTACCGTCGTCTTCTTCATTCATCATCATAGTCTTCTTATCTTGATGATGATGATGA
TGATGATCTCTCTTCATGGGTTGGTTTTTTTTCAAAGATGGATCTAAAAGGTTTTTCCTT
CAATGTCGGATCTAGGTTTTGCTTT

Last Updated on 07.07.2016 14:16