Sequences from confirmation amplicon


Confirmation sequences for line 355H08 and hit At3g25250 are shown.
Line ID 355H08
Locus At3g25250 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:9196605
Primers used for PCR KP06 - 8474, show primer details
   
Sequence Name 18-K023836-022-355-H08C-8409
GenBank Accession LN494139 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>18-K023836-022-355-H08C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATAACCGTGTTTATTCTA
ATCAAATCACGCAACGACGTCGTTTCACCAGTTAGATTCGGCGGTTTAGATAAAATCCGG
TAAAATGTCTCTTTCCGGTTCGATCCTCTAAACGGCGTCGCTCCATACAACATCTCATAT
AAAACAACCCCTAACGACCACCAATCGACGGCAAAATCGTGACCGTCCCCGCTTATAACC
TCCGGCGCAACGTATTCCTCTGTTCCGACGAAAGAATTTGACTTCTCACCTGAAGAATCT
GACACGGCCAATGTAGATGATGAGTGAACCGAGATAGATTCTTGCGGCGAGATTCCTGAG
TTGCAGAAACTGGTGAAGCGGAAGAGACGTTTCTTTCTCTTCATCGTCGGCGATGGTTTA
GACAGTGACGGTGACGGTTGCGGCGTTCTTGGAGCT
   
Sequence Name 22-K023836-022-355-H08C-KP06
GenBank Accession LN495944 [GenBank]
Sequencing primer gene specific primer, KP06: 5'-CTACAAATCTAGCTCCAAGAACGC-3'
Sequence (A. th genome BLAST matches underlined)
>22-K023836-022-355-H08C-kp6
CCGTCACCGTCACTGTCTAAACCATCGCCGACGATGAAGAGAAAGAAACGTCTCTTCCGC
TTCACCAGTTTCTGCAACTCAGGAATCTCGCCGCAAGAATCTATCTCGGTTCACTCATCA
TCTACATTGGCCGTGTCAGATTCTTCAGGTGAGAAGTCAAATTCTTTCGTCGGAACAGAG
GAATACGTTGCGCCGGAGGTTATAAGCGGGGACGGTCACGATTTTGCCGTCGATTGGTGG
TCGTTAGGGGTTGTTTTATATGAGATGTTGTATGGAGCGACGCCGTTTAGAGGATCGAAC
CGGAAAGAGACATTTTACCGGATTTTATCTAAACCGCCGAATCTAACTGGTGAAACGACG
TCGTTGCGTGATTTGATTAGAATAAACACGGTTATATATTCAATTGTAAATGGCTTCATG
TCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGA
GTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATG
AAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATA
AACAA
Primers used for PCR FQ53 - 8474, show primer details
   
Sequence Name 11-K035333-022-355-H08C-8409
GenBank Accession LN491017 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K035333-022-355-H08C-8409
GCCGACTGCCTATAGAAGCCATTTACTAGCCGTAGGATCAACGTTGAGGAAATCAAGGGT
CATGATTTCTTCAGAGGAGTAGATTGGGAAAAGGTGATTTTGGTTTCTAGACCGCCGTAT
ATCCCGGCGCCGGACGACGGTGGTGATAAGGGAACCGATGTAAATACGAAGATGGATGTG
GAGAATATCGTCCAAGAGATTTTTGCTGCAAGACAAGAACGTGAGAAACAGAGTGGTGAT
AACAATAAAAACGCTAATATGAAAATTAAAGATAATACTAGTGGGGAATGGGTTAAGGGG
TTGAA
   
Sequence Name 11-K035333-022-355-H08C-FQ53
GenBank Accession LN491018 [GenBank]
Sequencing primer gene specific primer, FQ53: 5'-ATTATTCAACCCCTTAACCCATTC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K035333-022-355-H08C-FQ53
TTATTTTCTATTAGCGTTTTTATTGTTATCACCACTCTGTTTCTCACGTTCTTGTCTTGC
AGCAAAAATCTCTTGGACGATATTCTCCACATCCATCTTCGTATTTACATCGGTTCCCTT
ATCACCACCGTCGTCCGGCGCCGGGATATACGGCGGTCTAGAAACCAAAATCACCTTTTC
CCAATCTACTCCTCTGAAGAAATCATGACCCTTGATTTCCTCAACGTTGATCCTACGGCT
AGTAAATGGCTTCTATAGTGCAGTCGGCTTCATGTCCGGGAAATCTACATGGATCAGCAA
TGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCA
AAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAA
TTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCT
TTATTTCGACGTGTCTACATTCACGTCCAAATGGG

Last Updated on 23.10.2014 13:25