Sequences from confirmation amplicon


Confirmation sequences for line 357B06 and hit At3g66654 are shown.
Line ID 357B06
Locus At3g66654 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:2089773
Primers used for PCR JK33 - 8474, show primer details
   
Sequence Name 15-K024844-022-357-B06C-8409
GenBank Accession LN492801 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K024844-022-357-B06C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATGCAATTGAATACTGGTTTG
TATTAGGTAATGGTTTATCTCATTGCTGAAACGGCATTCCCTTGAAGTGATCTTTTTGAC
TGCAACAATACTCAATGTTCAACTTCTACTATTATATTAAGCTACAATATCGTCACAGAC
TGATTCAGCCCATTTCTCTTTAATGAGGTTTCATGTTCCAAACAAAAATTCCAAGAAGAG
TACAAGAGGACTTAAGGATCAAAATCAGTCAATCAAGAAACTAAAGCTACTTGAATCCTA
TCAAGCTAGAAGTAATACTCCTATTTAAGAACAAGTCATGACCTAGCTTAATCAAATTAC
TCTACTGTTCTTTTTCTATCTAACTTAAAGGAAAACAAACGAATTCCAATACTAACCATA
GATCTAGAAACTTGTCCACAACTTCAGGGGAACCTTCTTTGAAGAGTTCGACAGTTATAA
GTCCTTTTGATGTGTTTATATCCTACATGAGATAGGAAAATAGAAGCAAGATATCATTAA
AATCAATATTCAGATAAGACACATCACATTTTTTTTACTTCAAAAACTGATGAACAGAAC
ATAATACCATGATGAGAAATAAGAACAAGGATTAAAACAAGAAACT
   
Sequence Name 16-K024844-022-357-B06C-JK33
GenBank Accession LN493270 [GenBank]
Sequencing primer gene specific primer, JK33: 5'-CCTGTTTGCTTGCTTAAGTTTCTT-3'
Sequence (A. th genome BLAST matches underlined)
>16-K024844-022-357-B06C-JK33
ATCCTTGTTCTTATTTCTCATCATGGTATTATGTTCTGTTCATCAGTTTTTGAAGTAAAA
AAAATGTGATGTGTCTTATCTGAATATTGATTTTAATGATATCTTGCTTCTATTTTCCTA
TCTCATGTAGGATATAAACACATCAAAAGGACTTATAACTGTCGAACTCTTCAAAGAAGG
TTCCCCTGAAGTTGTGGACAAGTTTCTAGATCTATGGTTAGTATTGGAATTCGTTTGTTT
TCCTTTAAGTTAGATAGAAAAAGAACAGTAGAGTAATTTGATTAAGCTAGGTCATGACTT
GTTCTTAAATAGGAGTATTACTTCTAGCTTGATAGGATTCAAGTAGCTTTAGTTTCTTGA
TTGACTGATTTTGATCCTTAAGTCCTCTTGTACTCTTCTTGGAATTTTTGTTTGGAACAT
GAAACCTCATTAAAGAGAAATGGGCTGAATCAGTCTGTGACGATATTGTAGCTTAATATA
ATAGTAGAAGTTGAACATTGAGTATTGTTGCAGTCAAAAAGATCACTTCAAGGGAATGCC
TGTTTCAGCAATGAGATAAACCATTACCTAATACAAACCAGTATTCAATTGCATATATTC
AATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCANCAATGAGTATGATGGTCA
ATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAA

Last Updated on 23.10.2014 13:25