Sequences from confirmation amplicon


Confirmation sequences for line 364E01 and hit At3g20770 are shown.
Line ID 364E01
Locus At3g20770 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:7262142
Primers used for PCR MM53 - 8474, show primer details
   
Sequence Name 31-K020131-022-364-E01C-MM53
GenBank Accession LN499969 [GenBank]
Sequencing primer gene specific primer, MM53: 5'-TCTCTGTTTGGCTTTCTCTTTCTC-3'
Sequence (A. th genome BLAST matches underlined)
>31-K020131-022-364-E01C-MM53
CTGCTGGGACTTCTTCTTTGACAGGAAAGTCATGCATTTTAGCAACCATCCCAAAGTTTG
AAGAATTCATAACTTTTTCTGGCTTGAGCTCTTCCACTTCATAGTGAGACTCCTTCTCGA
AACCTTCAACATCGTATTGACTGCAATCATTCATCAGAAGCGAGCAACTTCCACCAGACA
GAGAAAGAGGTGGACATGACTCGGGATAAAGCTCTCTAGCCAAGGACTCTTCTTGGTTAA
TAATAGCAAGCCAGGTAGCACTCTCTTTAGCAGTCATCTTATCCTGCAAACATTTAGATT
GCCTCACGAGCTTACGGATCTTAGCAATATCAGGAAACATATGCTTGATAACCGCAGTCA
AAACGCCGACTTTCCACGCCTTCTTCAAATCATGAGGCTTCTTGTAAGGTGCAGGACCTT
GATCTTTAGGCAAACCAAGTTGAGGCCACCAATCCTCTTTCCCATTAGGCCACCACGGAG
GAGGAACTCCTTTCTCCAAAGGAAAACGTCTCTGAGGAGGATCACAGTGTTGCATCAACG
CAGACAAAAGCGATCCAAGAGTCGTGTCTTGAAGCTCTTGCAAGGTATGAGGAGTCGGTC
CAATCGGGTTATTACCTTCATGAATCCCCGGGATATTATTCTCCGCTTGATACTTGGTAA
TAGCCGCAATGACTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCC
ATATGGGAGAAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAA
   
Sequence Name 32-K020131-022-364-E01C-oriL
GenBank Accession LN500395 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>32-K020131-022-364-E01C-oriL
TAGATTTCCCGGACATGAAGTCATTGCGGCTATTACCAAGTATCAAGCGGAGAATAATAT
CCCGGGGATTCATGAAGGTAATAACCCGATTGGACCGACTCCTCATACCTTGCAAGAGCT
TCAAGACACGACTCTTGGATCGCTTTTGTCTGCGTTGATGCAACACTGTGATCCTCCTCA
GAGACGTTTTCCTTTGGAGAAAGGAGTTCCTCCTCCGTGGTGGCCTAATGGGAAAGAGGA
TTGGTGGCCTCAACTTGGTTTGCCTAAAGATCAAGGTCCTGCACCTTACAAGAAGCCTCA
TGATTTGAAGAAGGCGTGGAAAGTCGGCGTTTTGACTGCGGTTATCAAGCATATGTTTCC
TGATATTGCTAAGATCCGTAAGCTCGTGAGGCAATCTAAATGTTTGCAGGATAAGATGAC
TGCTAAAGAGAGTGCTACCTGGCTTGCTATTATTAACCAAGAAGAGTCCTTGGCTAGAGA
GCTTTATCCCGAGTCATGTCCACCTCTTTCTCTGTCTGGTGGAAGTTGCTCGCTTCTGAT
GAATGATTGCAGTCAATACGATGTTGAAGGTTTCGAGAAGGAGTCTCACTATGAAGTGGA
AGAGCTCAAGCCAGAAAAAGTTATGAATTCTTCAAACTTTGGGATGGTTGCTAAAATGCA
TGA

Last Updated on 23.10.2014 13:25