Sequences from confirmation amplicon


Confirmation sequences for line 367D06 and hit At2g13610 are shown.
Line ID 367D06
Locus At2g13610 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:5673892
Primers used for PCR MD13 - 8474, show primer details
   
Sequence Name 07-K024601-022-367-D06C-8409
GenBank Accession LN489095 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>07-K024601-022-367-D06C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAGAAATGATCACAAC
ATCTACACCTGTAGAGCAAGACAAAACATAGCATGATCACAACATTTCTCCATCTACTTT
CCTCTCCGTACCTTTCTTCTTTGAGTAGATCCTCCTCAGTCACCAAACATTTTCCGAATC
CATACTCCAAACACTTGTTTGATTTTGAGAACTCGTTAATCAGAAATCCTTCGAACGGGT
ACTTGAACAAGGAGATGTAGTGCATGAAAATCCAGTAACCAGGGATCTCATGGTTCGATA
TGAAGTAGCCGGAGAACAGAAAGAAGGAACCCATCACACCGGAAATCACTGAGTTTCCAA
CTATGAAATTAGGAACCAGTGCACTAAAGCACACAACCACCGAGTTTGCTGTGTAGAGGA
TCAACCAAATGAGGAGCGAAAAGTGTAGAAACGCCATGAAACTGGGGTTCAGTCCCACCA
GCCAGTACACTGGGGTTGAGAATAGAATAGCTAGGATGAGCAGAAATGGCAAGTAAACTA
GTCCATTAGCGACGGCATATGAAGACACTCTGTAGCTTCCACTAGAGGTCTCCTTCATCA
GAA
   
Sequence Name 08-K024601-022-367-D06C-MD13
GenBank Accession LN489559 [GenBank]
Sequencing primer gene specific primer, MD13: 5'-TGCAAGAAAGAGAGATTCTGATGA-3'
Sequence (A. th genome BLAST matches underlined)
>08-K024601-022-367-D06C-MD13
CCTCTAGTGGAAGCTACAGAGTGTCTTCATATGCCGTCGCTAATGGACTAGTTTACTTGC
CATTTCTGCTCATCCTAGCTATTCTATTCTCAACCCCAGTGTACTGGCTGGTGGGACTGA
ACCCCAGTTTCATGGCGTTTCTACACTTTTCGCTCCTCATTTGGTTGATCCTCTACACAG
CAAACTCGGTGGTTGTGTGCTTTAGTGCACTGGTTCCTAATTTCATAGTTGGAAACTCAG
TGATTTCCGGTGTGATGGGTTCCTTCTTTCTGTTCTCCGGCTACTTCATATCGAACCATG
AGATCCCTGGTTACTGGATTTTCATGCACTACATCTCCTTGTTCAAGTACCCGTTCGAAG
GATTTCTGATTAACGAGTTCTCAAAATCAAACAAGTGTTTGGAGTATGGATTCGGAAAAT
GTTTGGTGACTGAGGAGGATCTACTCAAAGAAGAAAGGTACGGAGAGGAAAGTAGATGGA
GAAATGTTGTGATCATGCTATGTTTTGTCTTGCTCTACAGGTGTAGATGTTGTGATCATT
TCTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAA
TGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCA
AAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAA
TTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATT
Primers used for PCR DC15 - 8474, show primer details
   
Sequence Name 39-K031137-022-367-D06C-DC15
GenBank Accession LN503249 [GenBank]
Sequencing primer gene specific primer, DC15: 5'-TGCAAGAAAGAGAGATTCTGATGA-3'
Sequence (A. th genome BLAST matches underlined)
>39-K031137-022-367-D06C-DC15
TATGCCGTCGCTAATGGACTAGTTTACTTGCCATTTCTGCTCATCCTAGCTATTCTATTC
TCAACCCCAGTGTACTGGCTGGTGGGACTGAACCCCAGTTTCATGGCGTTTCTACACTTT
TCGCTCCTCATTTGGTTGATCCTCTACACAGCAAACTCGGTGGTTGTGTGCTTTAGTGCA
CTGGTTCCTAATTTCATAGTTGGAAACTCAGTGATTTCCGGTGTGATGGGTTCCTTCTTT
CTGTTCTCCGGCTACTTCATATCGAACCATGAGATCCCTGGTTACTGGATTTTCATGCAC
TACATCTCCTTGTTCAAGTACCCGTTCGAAGGATTTCTGATTAACGAGTTCTCAAAATCA
AACAAGTGTTTGGAGTATGGATTCGGAAAATGTTTGGTGACTGAGGAGGATCTACTCAAA
GAAGAAAGGTACGGAGAGGAAAGTAGATGGAGAAATGTTGTGATCATGCTATGTTTTGTC
TTGCTCTACAGGTGTAGATGTTGTGATCATTTCTCAGGATATATTCAATTGTAAATGGCT
TCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAG
AAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATA
AAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAG
CAATAAAACAATNATTCTAATTCGGAAATCTTTATNTCGACGTGTCTAC
   
Sequence Name 04-K031137-022-367-D06C-8409
GenBank Accession LN487796 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>04-K031137-022-367-D06C-8409
TGAGCATTTACAATTGAATATATCCTGAGAAATGATCACAACATCTACACCTGTAGAGCA
AGACAAAACATAGCATGATCACAACATTTCTCCATCTACTTTCCTCTCCGTACCTTTCTT
CTTTGAGTAGATCCTCCTCAGTCACCAAACATTTTCCGAATCCATACTCCAAACACTTGT
TTGATTTTGAGAACTCGTTAATCAGAAATCCTTCGAACGGGTACTTGAACAAGGAGATGT
AGTGCATGAAAATCCAGTAACCAGGGATCTCATGGTTCGATATGAAGTAGCCGGAGAACA
GAAAGAAGGAACCCATCACACCGGAAATCACTGAGTTTCCAACTATGAAATTAGGAACCA
GTGCACTAAAGCACACAACCACCGAGTTTGCTGTGTAGAGGATCAACCAAATGAGGAGCG
AAAAGTGTAGAAACGCCATGAAACTGGGGTTCAGTCCCACCAGCCAGTACACTGGGGTTG
AGAATAGAATAGCTAGGATGAGCAGAAATGGCAAGTAAACTAGTCCATTAGCGACGGCAT
ATGAAGACACTCTGTAGCTTCCACTAGAGGTCTCCTTCATCAGAATCTCTTTNTCTTGCA
ATGAGTAT

Last Updated on 07.07.2016 14:16