Sequences from confirmation amplicon


Confirmation sequences for line 368G05 and hit At5g02180 are shown.
Line ID 368G05
Locus At5g02180 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:432950
Primers used for PCR UF07 - 8474, show primer details
   
Sequence Name 27-K021643-022-368-G05C-8409
GenBank Accession LN498192 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>27-K021643-022-368-G05C-8409
CATTTACATTGAATAATCCTGATAGTTATGAGTCTCGAAGAACTCATTCCAACAGCTAAG
ATGAGATCACGTGGTGTATCGATATTATTTAGAACAATGCTAGTTACCTCTACTTTGGTG
GTTGCTCTTTCAGTTCCTTTCTTCGGTAATGTCTCTATGTATCCCTAACTTCCTACGCAA
GACACTCATCCCACTATAGCTTCTCTGATCGAATTTTCTCAATTACAGCGATCGTGGCAG
CACTAATCGGATCGTTCCTTGCAATGCTTGTGGTAAGTTCTTCCATCCCAAAAAAATTGA
AACTAAACATTATCAAACCCAAGGATATTTCATTT
   
Sequence Name 28-K021643-022-368-G05C-UF07
GenBank Accession LN498662 [GenBank]
Sequencing primer gene specific primer, UF07: 5'-AAAAATGAATATCCTTGGGTTTGA-3'
Sequence (A. th genome BLAST matches underlined)
>28-K021643-022-368-G05C-UF07
TTTTTGGGAGGAGACTTACCACAAGCATTGCAAGGAACGATCCGATTAGTGCTGCCACGA
TCGCTGTAATTGAGAAAATTCGATCAGAGAAGCTATAGTGGGATGAGTGTCTTGCGTAGG
AAGTTAGGGATACATAGAGACATTACCGAAGAAAGGAACTGAAAGAGCAACCACCAAAGT
AGAGGTAACTAGCATTGTTCTAAATAATATCGATACACCACGTGATCTCATCTTAGCTGT
TGGAATGAGTTCTTCGAGACTCATAACTATCAGGATATATTCAATTGTAAATGGCTTCAT
GTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAG
AGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAAT
GAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAAT
AAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 07.07.2016 14:16