Sequences from confirmation amplicon


Confirmation sequences for line 369A04 and hit At3g22840 are shown.
Line ID 369A04
Locus At3g22840 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:8084964
Primers used for PCR DE24 - 8474, show primer details
   
Sequence Name 09-K021340-022-369-A04C-8409
GenBank Accession LN489984 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>09-K021340-022-369-A04C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGATCCATGTGCTCACCTATATTCACCACCCC
AAAAGTTATTAACAAAGATTCACAAATAAAGCTTGTTTAATGAATTTTCAAGATTGTATG
TTCTTAATATCTAAGACCCGATTAATTAAAATACAAATTCTTGTTTATCAAAACTTCTAA
AATTATACCTTAGGTTTCATAGGAGGAGGAGGAGATGGTGACTTCGGCAACGGCTGAGCG
GCCGAGGTAGATGGTGCTGGTGAAGAGTCTTCATTCGTGGGTCCTCCCTGAAAAAGTCAA
ATAATCAGACGGTCAGGATTTCATAGTCACATGATGAATGGCCGTTGTATCAGGGAAGTG
GAGAATAACGTACCTCA
   
Sequence Name 10-K021340-022-369-A04C-DE24
GenBank Accession LN490458 [GenBank]
Sequencing primer gene specific primer, DE24: 5'-GCTGAGGTACGTTATTCTCCACTT-3'
Sequence (A. th genome BLAST matches underlined)
>10-K021340-022-369-A04C-DE24
GATACAACGGCCATTCATCATGTGACTATGAAATCCTGACCGTCTGATTATTTGACTTTT
TCAGGGAGGACCCACGAATGAAGACTCTTCACCAGCACCATCTACCTCGGCCGCTCAGCC
GTTGCCGAAGTCACCATCTCCTCCTCCTCCTATGAAACCTAAGGTATAATTTTAGAAGTT
TTGATAAACAAGAATTTGTATTTTAATTAATCGGGTCTTAGATATTAAGAACATACAATC
TTGAAAATTCATTAAACAAGCTTTATTTGTGAATCTTTGTTAATAACTTTTGGGGTGGTG
AATATAGGTGAGCACATGGATCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGA
TCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTT
CAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAA
CGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCG
GAAATCTTTATTTCGACGTGTCTACATTCA
Primers used for PCR CT32 - 3144, show primer details
   
Sequence Name 21-K105032-0022-369-A04C-CT32
GenBank Accession LN495653 [GenBank]
Sequencing primer gene specific primer, CT32: 5'-TTTTTAACCCGAAGTTTCAAAATG-3'
Sequence (A. th genome BLAST matches underlined)
>21-K105032-0022-369-A04C-CT32
GATTACTTTACAGAGAAATTACATGGGCAAAATCCTATTAAAACATCCTCCCGATAACGT
GCTCTCTTTTCCTTACACGAGTGTCCCACCTTTGACGAACTCAGTGAACGCCAACGCGAC
CAAACCGAGCATCGCGAAACGTCCGTTCCAAAGCTCAGCGTCTGACGTCATGATACCTTT
GGACTTGGACTCAACGCTTATGCCCTTGAAAAGCGGCACAAGCGACGCAAGTGTCAAGAT
CGCTGTTGTACCGAGGAACCATGAGACGCCACCGTCGGAGATCTGAGCTAAAACGTTTTC
ACCCTTGGATAGCTCGACAGCCAACGCCGCAACGAATCCAACCATCGCTAAACGTCCGTT
AATCCTCTCTGGTGCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACA
TGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTT
TTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGAT
AAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAA
TTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCCAAATGGGGGCTTAGATGAGAA
ACTTCACGATCGATGCCTTGATTTCGCCATTCCCAGATACCCATTTCATCTTCAGATTGG
TCTGAGATTATGCGAAAATATACACTCATATACATAAATACTGACAGTTTGAGCTACCAA
TTCAGTGTAGCCCATTACCTTACATAATTCACTCAAATGCTAGGCAGTCTGTCAACTCGG
CGTCAATTTGTCGGCCACTATACGATAGTTGCGCAAATTTCAAAGTCCTGGGCTAACATC
ACACCTCTGT

Last Updated on 07.07.2016 14:16