Sequences from confirmation amplicon


Confirmation sequences for line 376A06 and hit At2g20920 are shown.
Line ID 376A06
Locus At2g20920 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:8999451
Primers used for PCR RU55 - 8474, show primer details
   
Sequence Name 07-K026484-022-376-A06C-8409
GenBank Accession LN489110 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>07-K026484-022-376-A06C-8409
AGATTTCCCGGACATGAAGCCCTCTACAATTGAATATGACCAAAAAGAAAGTCAAAACCA
GAAGATTCAAAGGAACTCCCATTCACATAAGTCAAAACCATCATGGCTCCATAGACTCCA
GCTTGTATCCCGAGATCGCTCGTGGAAGGCATATCAACAGAGACAGGTGGATTCTTCATC
CACTGAGTCACAGTACTTGTTCCCAGAGGGTTACTAGATTTAACATCAGCGTAGCGAATG
TTGTTGCTTACAACTTTTCCTGCTCGGCGTTGGTTTAGGCTCTGCATCAGCAGCATGTCA
TATGCAGCCTCAGCCTGAGAAAATTACAGTGAGGCTTAAGAACAAGAAAGTCTATCTCTT
TCCATGGAAGCTAAAACTAGTAATGGAACAAATATAGAAAATTAGCGAATTTGTTGATTG
GAGAGTGAAA
   
Sequence Name 08-K026484-022-376-A06C-RU55
GenBank Accession LN489574 [GenBank]
Sequencing primer gene specific primer, RU55: 5'-CAATTTTCACTCTCCAATCAACAA-3'
Sequence (A. th genome BLAST matches underlined)
>08-K026484-022-376-A06C-RU55
TTTTCTATATTTGTTCCATTACTAGTTTTAGCTTCCATGGAAAGAGATAGACTTTCTTGT
TCTTAAGCCTCACTGTAATTTTCTCAGGCTGAGGCTGCATATGACATGCTGCTGATGCAG
AGCCTAAACCAACGCCGAGCAGGAAAAGTTGTAAGCAACAACATTCGCTACGCTGATGTT
AAATCTAGTAACCCTCTGGGAACAAGTACTGTGACTCAGTGGATGAAGAATCCACCTGTC
TCTGTTGATATGCCTTCCACGAGCGATCTCGG

Last Updated on 07.07.2016 14:16