Sequences from confirmation amplicon


Confirmation sequences for line 379C07 and hit At1g17040 are shown.
Line ID 379C07
Locus At1g17040 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:5825525
Primers used for PCR XD03 - 8474, show primer details
   
Sequence Name 01-K021642-022-379-C07C-8409
GenBank Accession LN486395 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K021642-022-379-C07C-8409
GCCATTTACAATTGATGAAAACAAGAAGATGATGCTTTTGCCATTGACTCTCCTTCACAG
GGAAGCTCCTGATCCTGTTAACACTTCTTCTTGGACTGAAGTTCCTAATGTTTCTACAAC
GGCTAAGTTTCCTCTTCAAAAATGGGTTCATGTGGGTTGTGAGGTAGTAATTATAAGATC
TCTGAGGACTCTTATTAATTTGACCAATATCTCTTTTCTTCGGATTTACTGATTTCTGTT
GTCTCCTAGGTTTCTAGAAACTATATGCGCCTTTATATTTGTGGAGAGCTTGTAGGAGAG
CAAGTCTTAACTTCCTTGATGACCAATGGTACAAATTCAGATTGCGCACGAAAGATATCG
TTATTTAGTGTTGGTGGAGATGGTTATAGTGTTCAGGGTTTCATCCACAGTGCAGAAGTT
TTGCCTTCTAATCTCTCTGCAAGTTATCACTACACAAAGGTAGTTTCTTGTCTTTGCCTT
CTCTTCTTTTTCAACAAAAGACTCTTGTCCTGTGTTTCTTTATTTCGCTTCATTTCTTTT
CCAGGACCCACCTTTATGGTTATCTGTTGATAAGCCATCTACATCTGGAAAA
   
Sequence Name 02-K021642-022-379-C07C-XD03
GenBank Accession LN486850 [GenBank]
Sequencing primer gene specific primer, XD03: 5'-TTCCAGATGTAGATGGCTTATCAA-3'
Sequence (A. th genome BLAST matches underlined)
>02-K021642-022-379-C07C-XD03
AATGAAGCGAAATAAAGAAACACAGGACAAGAGTCTTTTGTTGAAAAAGAAGAGAAGGCA
AAGACAAGAAACTACCTTTGTGTAGTGATAACTTGCAGAGAGATTAGAAGGCAAAACTTC
TGCACTGTGGATGAAACCCTGAACACTATAACCATCTCCACCAACACTAAATAACGATAT
CTTTCGTGCGCAATCTGAATTTGTACCATTGGTCATCAAGGAAGTTAAGACTTGCTCTCC
TACAAGCTCTCCACAAATATAAAGGCGCATATAGTTTCTAGAAACCTAGGAGACAACAGA
AATCAGTAAATCCGAAGAAAAGAGATATTGGTCAAATTAATAAGAGTCCTCAGAGATCTT
ATAATTACTACCTCACAACCCACATGAACCCATTTTTGAAGAGGAAACTTAGCCGTTGTA
GAAACATTAGGAACTTCAGTCCAAGAAGAAGTGTTAACAGGATCAGGAGCTTCCCTGTGA
AGGAGAGTCAATGGCAAAAGCATCATCTTCTTGTTTTCATCAATTGTAAATGGCTTCATG
TCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGA
GTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATG
AAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATA
AACAAATTATTCTAATTCGGAAATCTTTATNTCGACGTGTCTA

Last Updated on 23.10.2014 13:25