Sequences from confirmation amplicon


Confirmation sequences for line 380B01 and hit At1g71680 are shown.
Line ID 380B01
Locus At1g71680 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:26944978
Primers used for PCR RK26 - 8474, show primer details
   
Sequence Name 41-K021644-022-380-B01C-8409
GenBank Accession LN503921 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>41-K021644-022-380-B01C-8409
CCAGTCTAGAGAAGCCAAATGGTATTACTCCGCCTTCCACAATGTCACGGCCATGGTTGG
CGCCGGAGTTCTTGGTCTCCCTTTCGCCATGTCACAACTTGGCTGGTAATTTTTTAAGAA
ATGTTTAAATTTGTCTGATCTTAACTTCACAAAATAAAGTCGTAATTTAACGATAAATTT
GTTGCTAACAGGGGACCTGGACTTGTTGCTATAATAATGTCATGGGCTATAACGTTCTAC
TCGTTATGGCAAATGGTACAGTTGCACGAAGCCGTTCCAGGGAAACGGTTGGACCGTTAC
CCCGAGCTAGGGCAAGAAGCTTTTGGACCAAAACTAGGTTACTGGATCGTCATGCCGCAA
CAGCTTCTTGTCCAAATCGCTTCCGACATAGTCTACAACGTGACAGGAGGAAAATCTCTC
AAGAAATTTGTCGAGCTTCTATTTCCGAATCTCGAACATATCCGTCAGACTTATTACATC
CTTGGATTCGCCGCGCTTCAGCTTG
   
Sequence Name 42-K021644-022-380-B01C-RK26
GenBank Accession LN504310 [GenBank]
Sequencing primer gene specific primer, RK26: 5'-AGATTGAGAGAGGACAAGCTGAAG-3'
Sequence (A. th genome BLAST matches underlined)
>42-K021644-022-380-B01C-rk26
GTATAGTCTGACGGATATGTTCGAGATTCGGAAATAGAAGCTCGACAAATTTCTTGAGAG
ATTTTCCTCCTGTCACGTTGTAGACTATGTCGGAAGCGATTTGGACAAGAAGCTGTTGCG
GCATGACGATCCAGTAACCTAGTTTTGGTCCAAAAGCTTCTTGCCCTAGCTCGGGGTAAC
GGTCCAACCGTTTCCCTGGAACGGCTTCGTGCAACTGTACCATTTGCCATAACGAGTAGA
ACGTTATAGCCCATGACATTATTATAGCAACAAGTCCAGGTCCCCTGTTAGCAACAAATT
TATCGTTAAATTACGACTTTATTTTGTGAAGTTAAGATCAGACAAATTTAAACATTTCTT
AAAAAATTACCAGCCAAGTTGTGACATGGCGAAAGGGAGACCAAGAACTCCGGCGCCAAC
CATGGCCGTGACATTGTGGAAGGCGGAGTAATACCATTTGGCTTCTCTAGACTGGCTTCA
TGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAA
GAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAA
TGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAA
TAAACAAATTATTCTAATTCGGAAATCTTTATNTCGACGTGTCTAC

Last Updated on 07.07.2016 14:16