Sequences from confirmation amplicon


Confirmation sequences for line 380E07 and hit At1g30100 are shown.
Line ID 380E07
Locus At1g30100 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:10571878
Primers used for PCR ZZ45 - 8474, show primer details
   
Sequence Name 11-K021340-022-380-E07C-8409
GenBank Accession LN490919 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K021340-022-380-E07C-8409
TAGATTATTTTTTCATTTACATGGTTCACGCCGTTAAAATCACTAACGGAGACGCGAGTT
ACTCGTGCCGGTTTACGGAAACCGAGAGATTGGTTCAAGAGAAACAACTCGGTTCTCCGA
TTTTCCCTAAAGCTATAGGTGAGCTACATGGTCACTCTGGAATCGCACGGTTGATGCTAT
TTTACGCACGTGGTTTATTCGGTTTATTAAATCACAAAAACGGAACCGGAGTTGCTAACG
CCGGTTTGGTTTACTTCCACGACCGGTTATTAGCTATGTCTGAAGATGATCTACCTTACC
AAGTTCGTGTCACTGACAATGGCGATTTAGAGACCATCGGAAGATT
   
Sequence Name 12-K021340-022-380-E07C-ZZ45
GenBank Accession LN491380 [GenBank]
Sequencing primer gene specific primer, ZZ45: 5'-GAATCTTCCGATGGTCTCTAAATC-3'
Sequence (A. th genome BLAST matches underlined)
>12-K021340-022-380-E07C-ZZ45
GTCAGTGACACGAACTTGGTAAGGTAGATCATCTTCAGACATAGCTAATAACCGGTCGTG
GAAGTAAACCAAACCGGCGTTAGCAACTCCGGTTCCGTTTTTGTGATTTAATAAACCGAA
TAAACCACGTGCGTAAAATAGCATCAACCGTGCGATTCCAGAGTGACCATGTAGCTCACC
TATAGCTTTAGGGAAAATCGGAGAACCGAGTTGTTTCTCTTGAACCAATCTCTCGGTTTC
CGTAAACCGGCACGAGTAACTCGCGTCTCCGTTAGTGATTTTAACGGCGTGAACCATGTA
AATGAAAAAATAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGA
AAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAA
AATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGC
AATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 23.10.2014 13:25