Sequences from confirmation amplicon


Confirmation sequences for line 386D04 and hit At4g10960 are shown.
Line ID 386D04
Locus At4g10960 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:6716181
Primers used for PCR MP20 - 8474, show primer details
   
Sequence Name 55-K020436-022-386-D04C-8409
GenBank Accession LN508670 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>55-K020436-022-386-D04C-8409
ATCCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGATCAAGCCAAATATGGGATT
GAGGAGATGTGTAGAGATTTGTGGAACTGGGCTAGTAATAATCCTTATGGATATGATTCC
TCTTCTGAAGACAACTCTCATTAACTTTTCTTAATCGTTTTCTTCTTTTGCTAAAACATA
TTTCTCCACACTAAATTATTATAGTATCCGCAAGAAAAAACAACAACAATAAAGAGTCAG
ATTTTAGGGAAATATAGGGACATTATGTATTATTATTACAATCAATACTTAGTCTGTAAT
TGATTTGGATATGTTCTTGTATAATCAAAAAAGATTTGTTATGAATAGCTACAACGCAAA
TGTTTAGCTCTATACGGCAAAAAGTACCTTGAGGTTGACACGACGTCGTTTTCAGCTCGG
TGATAGTTGAAATGTATCTTTCTGAAGCTTTTAAGTTCAAGAGCCCACACACTTCTTCTC
ATTCTTTATAAACATAACACTGGACAGTAACCAAACTTCAGATCTGAATCAACCTCTTAA
GGTTCGTTTATACTCATTCTGTTTTTCACTGATAGTTTATGCACAATCC
   
Sequence Name 56-K020436-022-386-D04C-MP20
GenBank Accession LN508973 [GenBank]
Sequencing primer gene specific primer, MP20: 5'-ATAGAAGAAAGATTCGGATTGTGC-3'
Sequence (A. th genome BLAST matches underlined)
>56-K020436-022-386-D04C-MP20
ACTATCAGTGAAAAACAGAATGAGTATAAACGAACCTTAAGAGGTTGATTCAGATCTGAA
GTTTGGTTACTGTCCAGTGTTATGTTTATAAAGAATGAGAAGAAGTGTGTGGGCTCTTGA
ACTTAAAAGCTTCAGAAAGATACATTTCAACTATCACCGAGCTGAAAACGACGTCGTGTC
AACCTCAAGGTACTTTTTGCCGTATAGAGCTAAACATTTGCGTTGTAGCTATTCATAACA
AATCTTTTTTGATTATACAAGAACATATCCAAATCAATTACAGACTAAGTATTGATTGTA
ATAATAATACATAATGTCCCTATATTTCCCTAAAATCTGACTCTTTATTGTTGTTGTTTT
TTCTTGCGGATACTATAATAATTTAGTGTGGAGAAATATGTTTTAGCAAAAGAAGAAAAC
GATTAAGAAAAGTTAATGAGAGTTGTCTTCAGAAGAGGAATCATATCCATAAGGATTATT
ACTAGCCCAGTTCCACAAATCTCTACACATCTCCTCAATCCCATATTTGGCTTGATCAAT
TGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATA
TGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCA
GCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTT
ATAGGCGAAAGCAAT

Last Updated on 07.07.2016 14:16