Sequences from confirmation amplicon


Confirmation sequences for line 392B11 and hit At3g55080 are shown.
Line ID 392B11
Locus At3g55080 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:20415230
Primers used for PCR PG33 - 8474, show primer details
   
Sequence Name 45-K101715-0022-392-B11C-8409
GenBank Accession LN505474 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>45-K101715-0022-392-B11C-8409
ATTTACATTGAATATATCCTGTGATTAAAATATGGATTGTTAGACACATTTTCTCTATTC
AATAATTCTATTCATAGTTCCCTTTCAATGTAATGATCAGATTCTTTGTTGATACCTTCT
GTGGCAGCTTAATTTTTATATGACTTGTCTTGATGTTCTTTAATATGGTTCTGTCTTGTC
ATCAATAGTTGAAACATTGTACAACTTTGAATCATGTTATTTTGTCTTGTTTAGTAATCT
GATTGTTTTCCATCTTTATGCGATTGTTTAATGAGTGATTGTGAGAATAACCAATTTCAT
TTCCTACCAGAGGCTGTCTCCTGGTGTGATGCTTTATCTTTAATGTCAAATACACTAACC
ATGTTAATAACTATATCAACTTCTGAGCAGGTCACTGTTCGCCTCNCAAGTTATA
   
Sequence Name 45-K101721-0022-392-B11C-PG33
GenBank Accession LN505475 [GenBank]
Sequencing primer gene specific primer, PG33: 5'-TAGATAACTTTGGAGGCGAACAGT-3'
Sequence (A. th genome BLAST matches underlined)
>45-K101721-0022-392-B11C-PG33
TGGTTAGTGTATTTGACATTAAAGATAAAGCATCACACCAGGAGACAGCCTCTGGTAGGA
AATGAAATTGGTTATTCTCACAATCACTCATTAAACAATCGCATAAAGATGGAAAACAAT
CAGATTACTAAACAAGACAAAATAACATGATTCAAAGTTGTACAATGTTTCAACTATTGA
TGACAAGACAGAACCATATTAAAGAACATCAAGACAAGTCATATAAAAATTAAGCTGCCA
CAGAAGGTATCAACAAAGAATCTGATCATTACATTGAAAGGGAACTATGAATAGAATTAT
TGAATAGAGAAAATGTGTCTAACAATCCATATTTTAATCACAGGATATATTCAATTGTAA
ATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAG
AAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATTTCCACACGGTT
ATA
Primers used for PCR PG34 - 8474, show primer details
   
Sequence Name 35-K101745-0022-392-B11C-OriL
GenBank Accession LN501773 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>35-K101745-0022-392-B11C-OriL
ATTTACATTGAAAACGGATTTTGAAAAATACTTGCAAAGTTGCATCTTATTCAAAACATC
ATCAAGCCCACCTGCCATAGGTGGATTTCCCAATCGAAAGAGTATTAGTTATCTTTGCTC
CAGCAATTCGCTCTAACCAGGGTAAGAAGTTATTGTCCAACGAAGCCTAGATATAAAATG
GATAAGATGATCGTAAATCCTCTTTTGTGAGAGACATAAAAGTTCTGTACAACATCTTCT
TACATCAATTAGCTCCCAAAATCAACAGTCTGTTTGGTTAACTATAGATAGAAGAAGCTA
AAAGAACATAAAGGTTTCATCTTTGGTATCAATTGCTATCAGTAGAGGAGAAACATACAT
AACTTAGAAAAATTCTTGGAACCACACTCAGGTATGATAAAACTTTTCTAACACTTGAGA
TAATCAAGCTGTGAACAGTCCATCACATTGATTTCACAAAT
   
Sequence Name 35-K101751-0022-392-B11C-PG34
GenBank Accession LN501774 [GenBank]
Sequencing primer gene specific primer, PG34: 5'-AATTTGTGAAATCAATGTGATGGA-3'
Sequence (A. th genome BLAST matches underlined)
>35-K101751-0022-392-B11C-PG34
AAAGTTTTATCATACCTGAGTGTGGTTCCAGAATTTTTCTAAGTTATGTATGTTTCTCCT
CTACTGATAGCAATTGATACCAAAGATGAAACCTTTATGTTCTTTTAGCTTCTTCTATCT
ATAGTTAACCAAACAGACTGTTGATTTTGGGAGCTAATTGATGTAAGAAGATGTTGTACA
GAACTTTTATGTCTCTCACAAAAGAGGATTTACGATCATCTTATCCATTTTATATCTNGG
CTTCGTTGGACAATAACTTCTTACCCTGGTTAGAGCGAATTGCTGGAGCAAAGATAACTA
ATACTCTTTCGATTGGGAAATCCACCTATGGCAGGTGGGCTTGATGATGTTTTGAATAAG
ATGCAACTTTGCAAGTATTTTTCAAAATCCGTTTTTCAATTGTAAATGGCTTCATGTCCG
GGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAA
TTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCA

Last Updated on 07.07.2016 14:16