Sequences from confirmation amplicon


Confirmation sequences for line 396F12 and hit At5g15730 are shown.
Line ID 396F12
Locus At5g15730 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:5132366
Primers used for PCR EQ45 - 8474, show primer details
   
Sequence Name 05-K103074-0022-396-F12C-EQ45
GenBank Accession LN488309 [GenBank]
Sequencing primer gene specific primer, EQ45: 5'-ATTGGGTTGTTGTAGCTTATGGTC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K103074-0022-396-F12C-EQ45
AAGCACACAAAATTTCACAACCGTTCTAGGACAGGATCTTTTGGTCCTGTCTACAAAGCG
GTTATGCCCAATGGAGAATTAGCTGCAGCGAAAGTTCATGGCTCTAATTCAAGTCAAGGA
GACAGAGAGTTTCAAACCGAGGTAAGTGTACAGATCCACTCATTTCCCTGGTCCATGCAC
AATGGAGATAACAGAGCAGTATTGGTTTCTTGTTTCCAGGTATCTTTACTTGGGAGACTG
CATCACCGGAATCTTGTGAACTTGACAGGATACTGTGTCGATAAAAGTCACCGGATGTTG
ATCTATGAGTTCATGAGTAATGGAAGTTTGGAGAATCTTTTGTATGGCGGTGAGTCGTCC
TTTGTTTTCTTCTATCAATATAAGACGCAGCAAGAAATTAATCACAAGATTTTCTACTTT
ACTTTTCAGGTGAAGGAATGCAAGTCTTGAATTGGGAAGAGCGGCTTCAAATCGCTCTTG
ACATCTCCCACGGCATTGAATACCTTCACGAAGGGGCCGTACCGCCAGTTATTCACCGTG
ATCTTAAGTCAGCAAACATTTTGTTAGATCATTCCATGAGAGCTAAGGTAAGAGAGCAAA
TATTTAATACGCTTACTCAAAACTGTTTGGTTAAACCTTATAAAATTGGTCACGGATTTC
GGGTTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTC
AATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTC
CGC
   
Sequence Name 06-K103074-0022-396-F12C-8409
GenBank Accession LN488765 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>06-K103074-0022-396-F12C-8409
GCCATTTACACCCGAAATCCGTGACCAATTTTATAAGGTTTAACCAAACAGTTTTGAGTA
AGCGTATTAAATATTTGCTCTCTTACCTTAGCTCTCATGGAATGATCTAACAAAATGTTT
GCTGACTTAAGATCACGGTGAATAACTGGCGGTACGGCCCCTTCGTGAAGGTATTCAATG
CCGTGGGAGATGTCAAGAGCGATTTGAAGCCGCTCTTCCCAATTCAAGACTTGCATTCCT
TCACCTGAAAAGTAAAGTAGAAAATCTTGTGATTAATTTCTTGCTGCGTCTTATATTGAT
AGAAGAAAACAAAGGACGACTCACCGCCATACAAAAGATTCTCCAAACTTCCATTACTCA
TGAACTCATAGATCAACATCCGGTGACTTTTATCGACACAGTATCCTGTCAAGTTCACAA
GATTCCGGTGATGCAGTCTCCCAAGTAAAGATACCTGGAAACAAGAAACCAATACTGCTC
TGTTATCTCCATTGTGCATGGACCAGGGAAATGAGTGGATCTGTACACTTACCTCGGTTT
GAAACTCTCTGTCTCCTTGACTTGAATTAGAGCCATGAACTTTCGCTGCAGCTAATTCTC
CATTGGGCATAACCGCTTTGTAGACAGGACCAAAAGATCCTTGTCCTAGAACGGTTGTGA
AATTTTGTGTTGCTTTCTGAATATCCCTAAAGAAGTTTCAGACCATAAGCTACACNAACC
CA
Primers used for PCR 63wf - 8474, show primer details
   
Sequence Name 22-K118238-0022-396-F12C-63wf
GenBank Accession LN496305 [GenBank]
Sequencing primer gene specific primer, 63wf: 5'-TTAACACCAGCCAATAACCCTAAC-3'
Sequence (A. th genome BLAST matches underlined)
>22-K118238-0022-396-F12C-63wf
TACCCTTGACGATCTTCCTCATAACCAACACCAAACGATGAAGACATCGTGTCCTGTCTT
CTTCCTCGAGACCGACTTTGTTTGATCTTTAGTATGAACTGTGTTACTTCTCCAATAGAT
GGTCTTTTTCTTGGTGTCTTATGCACACACCTGTTTGCAATCTTCGCCAGTAACCTCACT
TCTTCAATGCTTGCGTTTCCCACTAGTTTCTGATCGAGTATTTCGTCGATACCATCTGGA
CTCATCGAAGCCTGATCATCAGAAAAACAGAATCATTGATCTCACAATCACTCACTGAGT
TTTGGTTCGATTTGGGTTTTAATTTCAGATTTTTGGGTTATTCGGTTTGGTTGCATAGAC
CAGGGATTTTAACTTACCAGGTTGATGTATTCCATCAGATTCTGTTGGGGATGGATTGCA
GTAATGAGCTCAAGAATGATGACACCGAAACTGTAAATGTCGCTCTTCATCGTGTATTTG
TTAGTCGAAATGTATGTTGGATCCATGTAGCCGTGAGTACCCTTCAATCCGGAAGTCATT
CTATCTAAAACCATCTCTTTCGACAACCCGAAATCCGCGACCTATACAAAAATAGTTCAC
GGAAATCCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCA
GCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAA
TTCAAAAATGTAGATGTCCGCA
   
Sequence Name 08-K118237-0022-396-F12C-8409
GenBank Accession LN489924 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>08-K118237-0022-396-F12C-8409
ATTGAATAATCCTGGATTTCCGTGAACTATTTTTGTATAGGTCGCGGATTTCGGGTTGTC
GAAAGAGATGGTTTTAGATAGAATGACTTCCGGATTGAAGGGTACTCACGGCTACATGGA
TCCAACATACATTTCGACTAACAAATACACGATGAAGAGCGACATTTACAGTTTCGGTGT
CATCATTCTTGAGCTCATTACTGCAATCCATCCCCAACAGAATCTGATGGAATACATCAA
CCTGGTAAGTTAAAATCCCTGGTCTATGCAACCAAACCGAATAACCCAAAAATCTGAAAT
TAAAACCCAAATCGAACCAAAACTCAGTGAGTGATTGTGAGATCAATGATTCTGTTTTTC
TGATGATCAGGCTTCGATGAGTCCAGATGGTATCGACGAAATACTCGATCAGAAACTAGT
GGGAAACGCAAGCATTGAAGAAGTGAGGTTACTGGCGAAGATTGCAAACAGGTGTGTGCA
TAAGACACCAAGAAAAAGACCATCTATTGGAGAAGTAACACAGTTCATACTAAAGATCAA
ACAAAGTCGGTCTCGAGGAAGAAGACAGGACACGATGTCTTCATCGTTTGGTGTTGGTTA
TGAGGAAGATCTGTCAAGGGTTATGAGCAGGATTAAGGATCAGCATGTTGAGTTAGGGTT
ATT

Last Updated on 07.07.2016 14:16