Sequences from confirmation amplicon


Confirmation sequences for line 418B07 and hit At1g65820 are shown.
Line ID 418B07
Locus At1g65820 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:24485038
Primers used for PCR FT01 - 8474, show primer details
   
Sequence Name 37-K023620-022-418-B07C-8409
GenBank Accession LN502468 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>37-K023620-022-418-B07C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTACAATTTGAAAATTACT
AATAAATTGAATAACATTCTCTGAAATATCAAAGAGCTTAAACTCATATTGGGCCTACGA
CTAAATGATTTAGGCCCATACGACTTATCATTTCCACATTGGGCCCAATCCATTCTTTCC
CGATAAATTCCGATGCAACTCCGATGATCGATCCGATGCGTCTTTGACTAGTAGATATTG
AGAAGCTCACATCATCAACGCTGGAGTTTCATACCTGGTACTACTTTCGTTTGAAGATTA
TTGGATCTTTTACTTGAGTGAGTATTATTAGATAAGAGTTATTACAATCTCATGGTGATA
AGTCATATACAGTAGAAACTCTATAAATTAATATTCGATAAATTAATAAACACGATAAAT
TAATAAACTTTACCGGTTCCAAGTCGGACCAA
   
Sequence Name 38-K023620-022-418-B07C-FT01
GenBank Accession LN502844 [GenBank]
Sequencing primer gene specific primer, FT01: 5'-TAATTTTTACATTGGTCCGACTTG-3'
Sequence (A. th genome BLAST matches underlined)
>38-K023620-022-418-B07C-FT01
CGGTAAAGTTTATTAATTTATCGTGTTTATTAATTTATCGAATATTAATTTATAGAGTTT
CTACTGTATATGACTTATCACCATGAGATTGTAATAACTCTTATCTAATAATACTCACTC
AAGTAAAAGATCCAATAATCTTCAAACGAAAGTAGTACCAGGTATGAAACTCCAGCGTTG
ATGATGTGAGCTTCTCAATATCTACTAGTCAAAGACGCATCGGATCGATCATCGGAGTTG
CATCGGAATTTATCGGGAAAGAATGGATTGGGCCCAATGTGGAAATGATAAGTCGTATGG
GCCTAAATCATTTAGTCGTAGGCCCAATATGAGTTTAAGCTCTTTGATATTTCAGAGAAT
GTTATTCAATTTATTAGTAATTTTCAAATTGTAGGATATATTCAATTGTAAATGGCTTCA
TGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAA
GAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAA
TGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAA
TAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATT

Last Updated on 07.07.2016 14:16