Sequences from confirmation amplicon


Confirmation sequences for line 429B11 and hit At1g49480 are shown.
Line ID 429B11
Locus At1g49480 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:18315218
Primers used for PCR LB01 - 8474, show primer details
   
Sequence Name 35-K024208-022-429-B11C-LB01
GenBank Accession LN501675 [GenBank]
Sequencing primer gene specific primer, LB01: 5'-TACTTGGTTCTGAGCTTTCAGTTG-3'
Sequence (A. th genome BLAST matches underlined)
>35-K024208-022-429-B11C-LB01
ACCTGATGGTCATGTTTGCATGTAGGACTAAGGAAAGCCAACAACAAAATCTGGTTTCAA
GACGGTTGGCAGGAGTTTGTCAACCGTTTCTCCATTCGGATTGGTTTCAGATACAAAGTT
ACAGTCTACATTTTCAATTTATCCTCCACACTCTGAGATCAACCACCATTCTAGTAGTGA
AGCTCTTATGCAAATGGATTCCGCACAGAATCAGTTCAACAAACGTGCTCGATTGTTTGA
AGATCCTGAACTCAAAGATGCTAAGGTCATTTATCCATCGAACCCTGAATCTACTGAACC
AGTGAATAAAGGTTATGGCGGTTCTACAGCCATCCAAAGCTTTTTCAAAGAATCTAAAGC
TGAAGAAACGCCCAAGGTACTTAAGAAGAGAGGAAGGAAGAAGAAGAATCCGGGAAATAT
ATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATG
GTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGAT
GTCCGCAGCGTTATTATAAAATGTAAGTACATTTTGATAAAACGACAAATTACGATCCGT
CGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCT
   
Sequence Name 36-K024208-022-429-B11C-8409
GenBank Accession LN502070 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>36-K024208-022-429-B11C-8409
CCGGACATGAAGCCATTTACAATTGAATATATTTCCCGGATTCTTCTTCTTCCTTCCTCT
CTTCTTAAGTACCTTGGGCGTTTCTTCAGCTTTAGATTCTTTGAAAAAGCTTTGGATGGC
TGTAGAACCGCCATAACCTTTATTCACTGGTTCAGTAGATTCAGGGTTCGATGGATAAAT
GACCTTAGCATCTTTGAGTTCAGGATCTTCAAACAATCGAGCACGTTTGTTGAACTGATT
CTGTGCGGAATCCATTTGCATAAGAGCTTCACTACTAGAATGGTGGTTGATCTCAGAGTG
TGGAGGATAAATTGAAAATGTAGACTGTAACTTTGTATCTGAAACCAATCCGAATGGAGA
AACGGTTGACAAACTCCTGCCAACCGTCTTGAAACCAGATTTTGTTGTTGGCTTTCCTTA
GTCCTACATGCAAACATGACCATCAGGTATTGTAAGTGCAAAAACAACTGAAAGCT
Primers used for PCR LB02 - 8474, show primer details
   
Sequence Name 27-K024286-022-429-B11C-LB02
GenBank Accession LN498213 [GenBank]
Sequencing primer gene specific primer, LB02: 5'-CATCTCCTTCGCCTATATTGTTCT-3'
Sequence (A. th genome BLAST matches underlined)
>27-K024286-022-429-B11C-LB02
TGAACTCATACCATCCTTGGCTAAACTTAGCTCTCCCTGCTTTGTAGAGGCACCTCACTG
GCCATTGTTTCTCACCGAGCTGGAGCTTGATGAAACCAGATATCCCACTTAGGTATTTCT
CAGCAAACCCAGATGGCAAGTACTGTTGAACAAACAAAAAACAGAAACGAAGAAGTCAGC
AAGAACAGGTCATGTTAACCCTAATCTTGAACCTTAATTACAATCTTTAAAAATTGTTTA
CCATGATGCAACCTCTGTATAGATATGATGGTCGCAGAACAACTCTAAAGTAAGGATTTG
TTGGTTCGAATGTTTTGGCTGCATTGACGGCTCTCTCTCTTTCCTCTGCAGTTACAGTTC
TCTTTCTAGCAGAAGCACTCTCGTAGAACTTTGAGCGGTTCTCTGAGTCATCTCCACCGG
GAGTTGAAGAGTTTACTTCCTCTGCACATACCAAAACAATAAATCTTTTGACTCTCCTCT
GAAACAAAAGTTAATACGTAATTAAGAGTCTGTCTCAATTGTAAATGGCTTCATGTCCGG
GAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAAT
TACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGT
ACATTTTGATAAAACGACAAATTACGA
   
Sequence Name 28-K024286-022-429-B11C-8409
GenBank Accession LN498680 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>28-K024286-022-429-B11C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAGACAGACTCTTAATTACGTATTAAC
TTTTGTTTCAGAGGAGAGTCAAAAGATTTATTGTTTTGGTATGTGCAGAGGAAGTAAACT
CTTCAACTCCCGGTGGAGATGACTCAGAGAACCGCTCAAAGTTCTACGAGAGTGCTTCTG
CTAGAAAGAGAACTGTAACTGCAGAGGAAAGAGAGAGAGCCGTCAATGCAGCCAAAACAT
TCGAACCAACAAATCCTTACTTTAGAGTTGTTCTGCGACCATCATATCTATACAGAGGTT
GCATCATGGTAAACAATTTTTAAAGATTGTAATTAAGGTTCAAGATTAGGGTTAACATGA
CCTGTTCTTGCTGACTTCTTCGTTTCTGTTTTTTGTTTGTTCAACAGTACTTGCCATCTG
GGTTTGCTGAGAAATACCTAAGTGGGATATCTGGTTTCATCAAGCTCCAGCTCGGTGAGA
AACAATGGCCAGTGAGGTGCCTCTACAAAGCAGGGAGAGCTAAGTTTAGCCAAGGATGGT
ATGAGTTCACACTCGAGAACAATA

Last Updated on 07.07.2016 14:16