Sequences from confirmation amplicon


Confirmation sequences for line 475B01 and hit At4g16215 are shown.
Line ID 475B01
Locus At4g16215 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:9179671
Primers used for PCR NC58 - 8474, show primer details
   
Sequence Name 25-K101325-0022-475-B01C-8409
GenBank Accession LN497371 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>25-K101325-0022-475-B01C-8409
TCCATTGGTATTGTTATCCTTAATCGATTAGTAGCTTACGGTTGACCGTTTAGCTCGGGA
AAAGCTCTAGCCTTGCTGGTTTGCCTTGTATCATTGGTCGGGTCAGTCGGATATATGGTC
CGCTTTTGGTTTAGGACCGGAACAACGAAAGCCGGGGATATTGAGTCTTTCTGATGATGC
GTCTCCGGGTGGTAATGCTATTGGGACATGGATTACATTCTGATCAATAGGGACTAATAG
TATGGATTTACTTTGTACTTCAGACTAGGTTTTGGTCTCTTCCGTTTTAGTAGTTGTTCT
CGTGTCGCTNAGAGTCTGTGTAGGTGGTCAAAGAGATG
   
Sequence Name 25-K101331-0022-475-B01C-NC58
GenBank Accession LN497372 [GenBank]
Sequencing primer gene specific primer, NC58: 5'-CATCTCTTTGACCACCTACACAGA-3'
Sequence (A. th genome BLAST matches underlined)
>25-K101331-0022-475-B01C-NC58
AACGGAAGAGACCAAAACCTAGTCTGAAGTACAAAGTAAATCCATACTATTAGTCCCTAT
TGATCAGAATGTAATCCATGTCCCAATAGCATTACCACCCGGAGACGCATCATCAGAAAG
ACTCAATATCCCCGGCTTTCGTTGTTCCGGTCCTAAACCAAAAGCGGACCATATATCCGA
CTGACCCGACCAATGATACAAGGCAAACCAGCAAGGCTAGAGCTTTTCCCGAGCTAACCA
ATCAACCGTAAGCTACTAATCGATTAAGGATAACAATTACCAATGGATCATGTCCGGGAA
ATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTAC
CAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC

Last Updated on 07.07.2016 14:16