Sequences from confirmation amplicon


Confirmation sequences for line 493F03 and hit At5g62100 are shown.
Line ID 493F03
Locus At5g62100 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:24940827
Primers used for PCR PB18 - 8474, show primer details
   
Sequence Name 09-K102498-0022-493-F03C-8409
GenBank Accession LN490123 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>09-K102498-0022-493-F03C-8409
CTTTCAAGACAAGAAAGAGACTCAAAGATGTTTCTTGATCTTTCTGGTGTCAAAGATCGT
TCGAAACTTATTCTTATAGAAGATCCCATTTCTCAGGAGAAACGTCTCCTTGAGTTGAGG
AAAATCGCCACCAAAGAGAAATCATCTAAAGCAATCTCTGATATTAGTTTCCAAGTCGAA
AGACTCGCCGGACAAGTAACTTAAGAAACATAATTTTAAATTTTCCGGATAACAACGCTC
TTGTCTCGTAACTTGAATCAGAATTGTTTTTTTTGGTTTTTGGACTTTAGCTGTCGGCGT
TTGATACAGTGATTGGTAAAGGAGGGAAAGTTGAAGAGAAGAATCTTGAGAATTTGATGG
AGATGTTGATGAATCAATTGGTCAAGCTCGATGCCATCTCAGGTGATGGAGACGTTAAAT
TGAAGAAGAAGATGCAGGTACTTAAATCATGTTTTATTACTCACTGTTACTAATCTAATT
CTTCATTTTACTTAGAATTCTAGATGACACAACTCTATTAATTTTTATTCATAAATTTGC
AGAATTATGGAACCATTCTATAAGTAATTACCAATCATACCCATAAAGTCTTGTTATTCA
AGTTTTTGAAGTC
   
Sequence Name 09-K102499-0022-493-F03C-PB18
GenBank Accession LN490124 [GenBank]
Sequencing primer gene specific primer, PB18: 5'-ATTGTCAAAGCGACTTCAAAAACT-3'
Sequence (A. th genome BLAST matches underlined)
>09-K102499-0022-493-F03C-PB18
ATTGGTATTACTTATAGAATGGTTCCATAATTCTGCAAATTTATGAATAAAAATTAATAG
AGTTGTGTCATCTAGAATTCTAAGTAAAATGAAGAATTAGATTAGTAACAGTGAGTAATA
AAACATGATTTAAGTACCTGCATCTTCTTCTTCAATTTAACGTCTCCATCACCTGAGATG
GCATCGAGCTTGACCAATTGATTCATCAACATCTCCATCAAATTCTCAAGATTCTTCTCT
TCAACTTTCCCTCCTTTACCAATCACTGTATCAAACGCCGACAGCTAAAGTCCAAAAACC
AAAAAAAACAATTCTGATTCAAGTTACGAGACAAGAGCGTTGTTATCCGGAAAATTTAAA
ATTATGTTTCTTAAGTTACTTGTCCGGCGAGTCTTTCGACTTGGAAACTAATATCAGAGA
TTGCTTTAGATGATTTCTCTTTGGTGGCGATTTTCCTCAACTCAAGGAGACGTTTCTCCT
GAGAAATGGGATCTTCTATAAGAATAAGTTTCGAACGATCTTTGACACCAGAAAGATCAA
GAAACATCTTTGAGTCTCTTTCTTTGTCTTTGTAAATGGCTTCATGTCCGGGAAATCTAC
ATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTT
TTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGA
TAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTA
ATTCGGAAATCTTTATTTCGACGTGTCTACA

Last Updated on 23.10.2014 13:25