Sequences from confirmation amplicon


Confirmation sequences for line 494F10 and hit At2g45550 are shown.
Line ID 494F10
Locus At2g45550 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:18773647
Primers used for PCR ZZ63 - 8474, show primer details
   
Sequence Name 39-K021644-022-494-F10C-8409
GenBank Accession LN503206 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>39-K021644-022-494-F10C-8409
CTTAGGAAGCTTCCAGTCAAAGGAATAAAGAAGAGAAGCAAGCATAAGAGACACCTGTTT
TCACAGCCAAAGGCAATCCCGGACATATTCTCCGTCCTCCTCCAAACGGTGTAAGCTCAT
AATCTCTACCTTTCACATCAATATCTTTCCCCATAAACCTCTCTGGCTCGAACTGGCTCG
GATTCTCCCATACGCTTGGGTCTCGTCCTATGGCCCACACATTCACTAGAACCTGAGTAT
CTTTAGGCACCATGAACCCAAGAACCTCCACATCTGATTCCGCTTTTCGTGGGACTAGTA
GCGGAGCAGCCGGATGTAACCTAAAAGTTTCCTTCACAACCGCTTGTAAATATGGCAATC
CTGAGATATCTGACTCTTGCACAACACTGTTTTGACCTAACACACGATCCATCTCTGCCT
GAGCTTTTACCATCGTTTTAGGGTTTCTAAGTAACTCTGCCATTGCCCACTCTAGAGTAC
TAGAGCTTGTATCTGTGCCAGCTGTAAACATATCCTGAAATACAATCATATATAAATAAG
TGAGCTTG
   
Sequence Name 40-K021644-022-494-F10C-ZZ63
GenBank Accession LN503562 [GenBank]
Sequencing primer gene specific primer, ZZ63: 5'-TTCCACAATGTCAAGCTCACTTAT-3'
Sequence (A. th genome BLAST matches underlined)
>40-K021644-022-494-F10C-ZZ63
GCTGGCACAGATCAAGCTCTAGTACTCTAGAGTGGGCAATGGCAGAGTTACTTAGAAACC
CTAAAACGATGGTAAAAGCTCAGGCAGAGATGGATCGTGTGTTAGGTCAAAACAGTGTTG
TGCAAGAGTCAGATATCTCAGGATTGCCATATTTACAAGCGGTTGTGAAGGAAACTTTTA
GGTTACATCCGGCTGCTCCGCTACTAGTCCCACGAAAAGCGGAATCAGATGTGGAGGTTC
TTGGGTTCATGGTGCCTAAAGATACTCAGGTTCTAGTGAATGTGTGGGCCATAGGACGAG
ACCCAAGCGTATGGGAGAATCCGAGCCAGTTCGAGCCAGAGAGGTTTATGGGGAAAGATA
TTGATGTGAAAGGTAGAGATTATGAGCTTACACCGTTTGGAGGAGGACGGAGAATATGTC
CGGGATTGCCTTTGGCTGTGAAAACAGTGTCTCTTATGCTTGCTTCTCTTCTTTATTCCT
TTGACTGGAAGCTTCCTAACGGTGTCGTTTCAGAGGAAAATCTACATGGATCAGCAATGA
GTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAA
ATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTA
CGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTA
TNTCGACGTGTCTAC

Last Updated on 23.10.2014 13:25