Sequences from confirmation amplicon


Confirmation sequences for line 529E05 and hit At2g47490 are shown.
Line ID 529E05
Locus At2g47490 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:19487580
Primers used for PCR BG36 - 8474, show primer details
   
Sequence Name 22-K101744-0022-529-E05C-8409
GenBank Accession LN496055 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>22-K101744-0022-529-E05C-8409
TTACATTGAATAATCCTGACTAAAACGTCCTCTGTAATGCAGCCGCCGGTGCCGCCGCCG
GTAATTCTCTGATCTGCTTCTTTCATAACTTTTTCTTAGATTTTGGTTTGGTTGATTAAA
GTTTCAAACTTTCTGATAGGGGTTGTTGCGGCTACGTTTGTGTGTCCTCTTGATGTTATA
AAAACGAGGTTTCAGGTTCATGGGCTGCCTAAGCTCGGTGATGCAAACATCAAAGGTTTG
TCCTTTTTCTTTCCCTTTAAATCTTCTCAGAAATTGGATTCCGTTGCTGATGTCATCGTA
TCTGGTTTTTGATCAGGTAGTCTAATTGTTGGCAGTCTTGAGCAGATCTTCAAGAGAGAA
GGGATGCGTGGCTTATACCGCGGTCTTTCCCCTACTGTCATGGCTCTTCTCTCCAATTGG
GCCGTGAGTTTTCACTTCTTCTTCTTGGAGCTATCTATCTTCTTTAATTCGGCTTTGTAC
TTATTCTACTTATTCAATAAGTCTTATTGGACTTTTGCAGATTTATTTTACAATGTATGA
CCAGCTCAGAAGCTTT
   
Sequence Name 22-K101750-0022-529-E05C-BG36
GenBank Accession LN496056 [GenBank]
Sequencing primer gene specific primer, BG36: 5'-AGAAAGCTCTTGAGCTGGTCATAC-3'
Sequence (A. th genome BLAST matches underlined)
>22-K101750-0022-529-E05C-BG36
GACTTATTGAATAAGTAGAATAAGTACAAAGCCGAATTAAAGAAGATAGATAGCTCCAAG
AAGAAGAAGTGAAAACTCACGGCCCAATTGGAGAGAAGAGCCATGACAGTAGGGGAAAGA
CCGCGGTATAAGCCACGCATCCCTTCTCTCTTGAAGATCTGCTCAAGACTGCCAACAATT
AGACTACCTGATCAAAAACCAGATACGATGACATCAGCAACGGAATCCAATTTCTGAGAA
GATTTAAAGGGAAAGAAAAAGGACAAACCTTTGATGTTTGCATCACCGAGCTTAGGCAGC
CCATGAACCTGAAACCTCGTTTTTATAACATCAAGAGGACACACAAACGTAGCCGCAACA
ACCCCTATCAGAAAGTTTGAAACTTTAATCAACCAAACCAAAATCTAAGAAAAAGTTATG
AAAGAAGCAGATCAGAGAATTACCGGCGGCGGCACCGGCGGCTGCATTACAGAGGACGTT
TATNGTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAG
CAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAAT
TCAAAAATGTAGATGTCCGCA

Last Updated on 23.10.2014 13:25