Sequences from confirmation amplicon


Confirmation sequences for line 550D06 and hit At1g15960 are shown.
Line ID 550D06
Locus At1g15960 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:5483141
Primers used for PCR RV01 - 8474, show primer details
   
Sequence Name 35-K024725-022-550-D06C-8409
GenBank Accession LN501679 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>35-K024725-022-550-D06C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGATATGCATATACTTATTCT
GGTTGTCTCACAGAACGTTGTGGGTAAATGGAGCTCAAAGCTATTTGCAATTGCGTTGCT
TGCTTCCGGTCAGAGTTCAACCATAACCGGAACATATGCTGGACAATACGTTATGCAGGT
GATCAAACTCTAGAAAAATGCTCCTAAGCCCTAACTTGTGTCTGAATCTTGTTCCTTCTC
TTATTTTCTTCAGGGGTTTCTTGATTTAAGACTAGAACCATGGCTCAGAAACTTCCTAAC
CAGATGCTTGGCTATAATCCCAAGTTTGATCGTTGCTTTGATAGGTGGCTCAGCTGGAGC
CGGAAAGTTAATCATCATTGCCTCGGTATAACCTCTTCCATAACTTAAATCCAATCTCTT
AATCACATACATACTTTATTAACATCAATCATCTTATATGTTTGCAGATGATCTTATCCT
TTGAACTCCCATTTGCTTTAGT
   
Sequence Name 36-K024725-022-550-D06C-RV01
GenBank Accession LN502075 [GenBank]
Sequencing primer gene specific primer, RV01: 5'-TTGAGAAGTGGGACTAAAGCAAAT-3'
Sequence (A. th genome BLAST matches underlined)
>36-K024725-022-550-D06C-RV01
CAAAGGATAAGATCATCTGCAAACATATAAGATGATTGATGTTAATAAAGTATGTATGTG
ATTAAGAGATTGGATTTAAGTTATGGAAGAGGTTATACCGAGGCAATGATGATTAACTTT
CCGGCTCCAGCTGAGCCACCTATCAAAGCAACGATCAAACTTGGGATTATAGCCAAGCAT
CTGGTTAGGAAGTTTCTGAGCCATGGTTCTAGTCTTAAATCAAGAAACCCCTGAAGAAAA
TAAGAGAAGGAACAAGATTCAGACACAAGTTAGGGCTTAGGAGCATTTTTCTAGAGTTTG
ATCACCTGCATAACGTATTGTCCAGCATATGTTCCGGTTATGGTTGAACTCTGACCGGAA
GCAAGCAACGCAATTGCAAATAGCTTTGAGCTCCATTTACCCACAACGTTCTGTGAGACA
ACCAGAATAAGTATATGCATATCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGA
AATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTA
CCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTAC
ATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAAT
TATTCTAATTCGGAAATCTTTATTTCGA
Primers used for PCR RV02 - 8474, show primer details
   
Sequence Name 49-K024726-022-550-D06C-8409
GenBank Accession LN506705 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>49-K024726-022-550-D06C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGGCTTTTTAATGGAGAAGTT
ATGCAAGAAATTGAAGCAAAAGATATAGGATTCATGGATTTACACGTAGCAGAAATGAAG
CTTTGTTTAAGTCCAAATCTTGGCAACTAGCTCGATCTTCTGGACTCAAATCTGAGGCAT
TACAAACTGCACCACTCACTGATATCACAGAGACATTGATGAGAAATGCCACCATAAGTG
CTAATCCGCTTTCTATCAAGTAATACCGACAAGCTTCCTGTAAATGAGAACAGGGAACTT
AAAGACTCACATAACGTCCATGAAAATGTATGTATGTTAGGTGATTAGTTACCTTGATGC
CGGTTACTGAACGAGGAATTTTCCTAGAGAGAACTAAAGCTGAGTGGAGAAAGAGATTGT
GCCTGTGAAGAATTAAAACAGATGAGTATTTTCGTAATTTGTTTGAGGGATAGAGAGACA
GAGAGTTGCTTACGGCATAACCATGGCACCGAGGAGAGATATCGCTAAACCAGTTGCACC
ATTACCCTTCAACTGAGGAACAAAGAGACCATAG
   
Sequence Name 50-K024726-022-550-D06C-RV02
GenBank Accession LN507046 [GenBank]
Sequencing primer gene specific primer, RV02: 5'-CAGACCCAAAAGAAGTCCTCTATG-3'
Sequence (A. th genome BLAST matches underlined)
>50-K024726-022-550-D06C-RV02
CTCTTTGTTCCTCAGTTGAAGGGTAATGGTGCAACTGGTTTAGCGATATCTCTCCTCGGT
GCCATGGTTATGCCGTAAGCAACTCTCTGTCTCTCTATCCCTCAAACAAATTACGAAAAT
ACTCATCTGTTTTAATTCTTCACAGGCACAATCTCTTTCTCCACTCAGCTTTAGTTCTCT
CTAGGAAAATTCCTCGTTCAGTAACCGGCATCAAGGTAACTAATCACCTAACATACATAC
ATTTTCATGGACGTTATGTGAGTCTTTAAGTTCCCTGTTCTCATTTACAGGAAGCTTGTC
GGTATTACTTGATAGAAAGCGGATTAGCACTTATGGTGGCATTTCTCATCAATGTCTCTG
TGATATCAGTGAGTGGTGCAGTTTGTAATGCCTCAGATTTGAGTCCAGAAGATCGAGCTA
GTTGCCAAGATTTGGACTTAAACAAAGCTTCATTTCTGCTACGTGTAAATCCATGAATCC
TATATCTTTTGCTTCAATTTCTTGCATAACTTCTCCATTAAAAAGCCAGGATATATTCAA
TTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAAT
ATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGAATGTCGC
AGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATT
TATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAAT

Last Updated on 07.07.2016 14:16