Sequences from confirmation amplicon


Confirmation sequences for line 562A02 and hit At1g47885 are shown.
Line ID 562A02
Locus At1g47885 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:17642397
Primers used for PCR NG38 - 8474, show primer details
   
Sequence Name 02-K102362-0022-562-A02C-8409
GenBank Accession LN486976 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>02-K102362-0022-562-A02C-8409
GCCATTTACATTGAATATATCCTAAAGTGTTGATATCCGCAGTATCATATGATCCAGATG
CCAACTAAATTTGTGAGAGGCTAAAGTCATGGGACGATACAAAAGAGAACTCATCATCAG
AGTCTCTAAACACTGAGGAATTGAGCCGTGGAGATTGTTGTCTAATAGATCTAGGGCGTA
TAGAGAGTTGAGTCCACATATTGACTGAGGTATCTCTCCGGTGAAGTTATTATTGAATCC
CAAAAAAATATTTGAGAGACCTGGACGTGATGAAGAGTGGTCCTTGGAAAGCGTCAACAC
CACCGCAACCTGAACCGCTGGAGACTAATGAAGAAGAAGAATCACTGAGTTGGGTAGCAG
CAGGTTTAGGCTTTGCACCTGGAGTTGTATTTGGACTGAATATGGC
   
Sequence Name 02-K102363-0022-562-A02C-NG38
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer gene specific primer, NG38: 5'-AGCCATATCCAGTCCAAATACAAC-3'
Sequence (A. th genome BLAST matches underlined)
>02-K102363-0022-562-A02C-NG38
CGGAATTTGCCCTCGGAGATTGGTGGCCCTAAAATCTCGGGTGCACCGAGAGTTGAGTCC
CAATTTTGACCGCGGGACC

Last Updated on 23.10.2014 13:25