Sequences from confirmation amplicon


Confirmation sequences for line 567F08 and hit At5g62380 are shown.
Line ID 567F08
Locus At5g62380 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:25051228
Primers used for PCR TD02 - 8474, show primer details
   
Sequence Name 43-K026694-022-567-F08C-8409
GenBank Accession LN504709 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>43-K026694-022-567-F08C-8409
GTAGATTTCCCGGACATGTAAATGGACCGCCTCATGAGGAAGGATGGGTGGTTTGTCGCG
CTTTCAAGAAGAAGCTAACCACGATGAACTACAACAATCCAAGAACAATGATGGGATCAT
CATCAGGCCAAGAATCTAACTGGTTCACGCAGCAAATGGATGTGGGGAATGGTAATTACT
ATCATCTTCCTGATCTAGAGAGTCCGAGAATGTTTCAAGGCTCATCATCATCATCACTAT
CATCATTACATCAGAATGATCAAGACCCTTATGGTGTCGTACTCAGCACTATTAACGCAA
CCCCAACTACAATAATGCAACGAGATGATGGTCATGTGATTACCAATGATGATGATCATA
TGATCATGATGAACACAAGTACTGGTGATCATCATCAATCAGGATTACTAGTCAATGATG
ATCATAATGATCAAGTAATGGATTGGCAAACGCTTGACAAGTTTGTTGCTTCTCAGCTAA
TCATGAGCCAAGAAGAGGAAGAAGTTAACAAAGATCCATCAGATAATTCTCGAATGAAAC
ATTTCATCATC
   
Sequence Name 44-K026694-022-567-F08C-TD02
GenBank Accession LN505054 [GenBank]
Sequencing primer gene specific primer, TD02: 5'-TTGCTCTTCAGAGAGATGATGAAA-3'
Sequence (A. th genome BLAST matches underlined)
>44-K026694-022-567-F08C-TD02
CTGTTTCATTCGAAGAATTATCTGATGGATCTTTGTTAACTTCTTCCTCTTCTTGGCTCA
TGATTAGCTGAGAAGCAACAAACTTGTCAAGCGTTTGCCAATCCATTACTTGATCATTAT
GATCATCATTGACTAGTAATCCTGATTGATGATGATCACCAGTACTTGTGTTCATCATGA
TCATATGATCATCATCATTGGTAATCACATGACCATCATCTCGTTGCATTATTGTAGTTG
GGGTTGCGTTAATAGTGCTGAGTACGACACCATAAGGGTCTTGATCATTCTGATGTAATG
ATGATAGTGATGATGATGATGAGCCTTGAAACATTCTCGGACTCTCTAGATCAGGAAGAT
GATAGTAATTACCATTCCCCACATCCATTTGCTGCGTGAACCAGTTAGATTCTTGGCCTG
ATGATGATCCCATCATTGTTCTTGGATTGTTGTAGTTCATCGTGGTTAGCTTCTTCTTGA
AAGCGCGACAAACCACCCATCCTTCCTCATGAGGCGGTCCATTTACATGTCCGGGAAATC
TACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAA
TTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTT
TGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATT
CTAATTCGGAAATCT

Last Updated on 07.07.2016 14:16