Sequences from confirmation amplicon


Confirmation sequences for line 574E01 and hit At3g17510 are shown.
Line ID 574E01
Locus At3g17510 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:5989320
Primers used for PCR MZ48 - 8474, show primer details
   
Sequence Name 43-K024725-022-574-E01C-8409
GenBank Accession LN504706 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>43-K024725-022-574-E01C-8409
ATTTCCCGGACATGTAGATTTCTCTTGCTCCGGCGAGGATGTGCCCACGTCTTTTAATAG
TCTCTCGTACAACTGCACCAACCCCAATATCAAACATAAACATTTTTATCTTTGATATGT
GTTTCTTCAGTCTAATTAAGAAATGACAATAGTGGCATACCTGTCTATATAAACATGAAT
CGCCATAAGATTTTCTTAGCTCAACCACGTTCAGTGACGGCTTTATCTCGAAAACCTGAT
ATCATAAGAATTTCTTCTATTAGTCAAATAATCTCACTAAATAGTCTATTGAACAGTGAA
ATAATGTTTACGTAATAGTTAATATACCTCAGCTGTTACTGATAAACCAACTTGACCTTT
CTGGTTTCTTTCTTCTTGTTTTACTCTTAACTGAAACAAAATACAGTTTAAAGTTTATAA
ACCTACAGATTTGAAATTCCAAGTTGCTAAGGAAGAGGAAGACCATGTTGTGAAGACCCA
CCTTGGCATGTTTCTTTTGTACACTGAATCCCATTTCTTGAACGGCTGTTTCGATTTTCT
CCAGTAAATCTTTTGCTGAGCTATTTGAAGTGAATCTTATTCTCCTCTCTGATACATTCT
GAGAAAGTAAAAGTATAACTCCTTTTTATTATACATTGGGCTCAG
   
Sequence Name 44-K024725-022-574-E01C-MZ48
GenBank Accession LN505051 [GenBank]
Sequencing primer gene specific primer, MZ48: 5'-GTTTCAAAGATCTGCTCTCTGCTT-3'
Sequence (A. th genome BLAST matches underlined)
>44-K024725-022-574-E01C-MZ48
CCAATGTATAATAAAAAGGAGTTATACTTTTACTTTCTCAGAATGTATCAGAGAGGAGAA
TAAGATTCACTTCAAATAGCTCAGCAAAAGATTTACTGGAGAAAATCGAAACAGCCGTTA
CAGAAATGGGATTCAGTGTACAAAAGAAACATGCCAAGGTGGGTCTTCACAACATGGTCT
TCCTCTTCCTTAGCAACTTGGAATTTCAAATCTGTAGGTTTATAAACTTTAAACTGTATT
TTGTTTCAGTTAAGAGTAAAACAAGAAGAAAGAAACCAGAAAGGTCAAGTTGGTTTATCA
GTAACAGCTGAGGTATATTAACTATTACGTAAACATTATTTCACTGTTCAATAGACTATT
TAGTGAGATTATTTGACTAATAGAAGAAATTCTTATGATATCAGGTTTTCGAGATAAAGC
CGTCACTGAACGTGGTTGAGCTAAGAAAATCTTATGGCGATTCATGTTTATATAGACAGG
TATGCCACTATTGTCATTTCTTAATTAGACTGAAGAAACACATATCAAAGATAAAAATGT
TTATGTTTGATATT

Last Updated on 23.10.2014 13:25