Sequences from confirmation amplicon


Confirmation sequences for line 587E08 and hit At2g25360 are shown.
Line ID 587E08
Locus At2g25360 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:10805619
Primers used for PCR NR52 - 8474, show primer details
   
Sequence Name 79-K102506-0022-587-E08C-8409
GenBank Accession LN513811 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>79-K102506-0022-587-E08C-8409
TTCAGAACCATATAACAAAGTCAAATACAACAATACAGTGCAAGTTTAAGAAACAAAGGA
GTAAATAAGAAAGTTAACATCATTTTTGGATTTGCCATTTGCTGATCAATATATTCTTCA
TAGCTAGGCCAACGACGACCTTCTTCATCAGAATAGTAATTACATGTATCTACTTCAAAA
TCATATTCCGGTTCATTATAATCATAATCATCATAATAACCATGTCCCGTTAGTAGGCAA
CCAGAAGAGCAAGTCTTTTGGTCATTCTTCCATTCAACCTCACATTGGTAACAAAACTGA
TATCCACATCTACACAATGAATGCACAAAGTTTAACATTACGAAATGAAAGTACTCGAAT
GATGTAGAATAATCGAGTTAAATAAATATATACCTGCAAGTCATGTGGTTGCAGGCATGA
GAAAGTTCGATCATGTGCCTACACATTTTACACTGACGCCATTTTTTGTCCTTTGCTAGA
GACTTTAGCTTCAACTCATCAACTAGAGGGTCATGGTGAAGTTTTTTGTACTCAGCACAC
GACAAATCAGAATGTGATGGTACTTTGCAATCAATGCAGAAGAGTCCACAACA
   
Sequence Name 79-K102507-0022-587-E08C-NR52
GenBank Accession LN513812 [GenBank]
Sequencing primer gene specific primer, NR52: 5'-CTTGTGTCAAATGTTGTGGACTCT-3'
Sequence (A. th genome BLAST matches underlined)
>79-K102507-0022-587-E08C-NR52
ATTCTGATTTGTCGTGTGCTGAGTACAAAAAACTTCACCATGACCCTCTAGTTGATGAGT
TGAAGCTAAAGTCTCTAGCAAAGGACAAAAAATGGCGTCAGTGTAAAATGTGTAGGCACA
TGATCGAACTTTCTCATGCCTGCAACCACATGACTTGCAGGTATATATTTATTTAACTCG
ATTATTCTACATCATTCGAGTACTTTCATTTCGTAATGTTAAACTTTGTGCATTCATTGT
GTAGATGTGGATATCAGTTTTGTTACCAATGTGAGGTTGAATGGAAGAATGACCAAAAGA
CTTGCTCTTCTGGTTGCCTACTAACGGGACATGGTTATTATGATGATTATGATTATAATG
AACCGGAATATGATTTTGAAGTAGATACATGTAATTACTATTCTGATGAAGAAGGTCGTC
GTTGGCCTAGCTATGAAGAATATATTGATCAGCAAATGGCAAATCCAAAAATGATGTTAA
CTTTCTTATTTACTCCTTTGTTTCTTAAACTTGCACTGTATTGTTGTATTTGACTTTGTT
ATATGGTTCTTGAAGCTATGACGCGCCGAGAGATGATCAGCAATGAGTATGATGGTCAAT
ATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC
AGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATT
TATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTA
CATTC

Last Updated on 07.07.2016 14:16