Sequences from confirmation amplicon


Confirmation sequences for line 591E12 and hit At3g08680 are shown.
Line ID 591E12
Locus At3g08680 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:2639863
Primers used for PCR CS05 - 8474, show primer details
   
Sequence Name 45-K026770-022-591-E12C-8409
GenBank Accession LN505400 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>45-K026770-022-591-E12C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCTTCATGGTAATATGA
TGTTTTACATGTTACTCAAGGTTATAAAAAGTGGCTTTAAAGTAACACTTTAGATGAATT
CTATGCAGGAAACAATGAGGGAGGAAGAGCAGCGTTGGACTGGGAAACAAGGTTAAGGAT
CTGTTTGGAAGCTGCGAGGGGAATTTCTCACATCCATTCTGCATCTGGTGCTAAACTCCT
CCATGGAAACATCAAATCACCAAATGTCCTCTTAACCCAAGAACTTCATGTCTGTGTCTC
TGATTTCGGTATAGCTCCATTGATGAGCCATCACACCTTGATCCCATCAAGAAGCTTAGG
TTACAGAGCACCCGAGGCCATAGAAACACGGAAACATACCC
   
Sequence Name 46-K026770-022-591-E12C-CS05
GenBank Accession LN505744 [GenBank]
Sequencing primer gene specific primer, CS05: 5'-CTGGGTATGTTTCCGTGTTTCTAT-3'
Sequence (A. th genome BLAST matches underlined)
>46-K026770-022-591-E12C-CS05
CTCGGGTGCTCTGTAACCTAAGCTTCTTGATGGGATCAAGGTGTGATGGCTCATCAATGG
AGCTATACCGAAATCAGAGACACAGACATGAAGTTCTTGGGTTAAGAGGACATTTGGTGA
TTTGATGTTTCCATGGAGGAGTTTAGCACCAGATGCAGAATGGATGTGAGAAATTCCCCT
CGCAGCTTCCAAACAGATCCTTAACCTTGTTTCCCAGTCCAACGCTGCTCTTCCTCCCTC
ATTGTTTCCTGCATAGAATTCATCTAAAGTGTTACTTTAAAGCCACTTTTTATAACCTTG
AGTAACATGTAAAACATCATATTACCATGAAGCAGGATATATTCAATTGTAAATGGCTTC
ATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAA
AGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAA
ATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCA
ATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCA

Last Updated on 07.07.2016 14:16