Sequences from confirmation amplicon


Confirmation sequences for line 592E06 and hit At2g14720 are shown.
Line ID 592E06
Locus At2g14720 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:6300973
Primers used for PCR HM75 - 8474, show primer details
   
Sequence Name 52-K101220-0022-592-E06C-OriL
GenBank Accession LN507753 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>52-K101220-0022-592-E06C-OriL
TACATGGACTCAGAGATCAGAGCCATAATGGCACAGTACATGCCACTGGACAGCCAACCT
GAGGTCCCGAACCACACGAATGATGAACGTGCCTAAGAGAACGAAATGGTCCATCTATTT
ATTCCCCCGGAAAGGAATCAATGCGAAGCGTTCTTTTAATTGATGTGGCCCTTGATACCG
GTGTTCTTTTTCGCATCTGTATCTCTGTAACTCTTTGTACCAAACAGTGTATCCTATGTT
CTTGTCAATTGTGTCCATGTGACTTCTGTAATAGGGAAACTTCGATGTAGCTACGGAGAA
CTGGACAAGCTAGTCAATAGAATCAAAACATCAAAGTGTTAAAGTTAAATCTTTTAGTCT
TGGACAAGTTAGACGACTCTCTCTTTGTAGTTTACACATAATGTCTTAAGATTTATGGTA
AATTAAGACAACATCAGATCGATATTTGTATTTATCAAACCCTGGAGTTGGGTTAAACCT
CAAACACACATTTAGGTTCCGCATAGTTTTGCTTAGATGTTTCATGATAGTCAAAATTAT
TAAAAATTAATAGTCGATAAGGTAATACACATGTTTTGTAACTCTTTTCCTTTGTTGTTG
GTCCAATGGCACAGTATCTTTGTAACTCAGTTAACAAACGGTGGGGATGCA
   
Sequence Name 52-K101227-0022-592-E06C-HM75
GenBank Accession LN507754 [GenBank]
Sequencing primer gene specific primer, HM75: 5'-TAAAATCTCTATTTGCATCCCCAC-3'
Sequence (A. th genome BLAST matches underlined)
>52-K101227-0022-592-E06C-HM75
TGGACCAACACAAGGAAAAGAGTTACAAAACATGTGTATTACCTTATCGACTATTAATTT
TTAATAATTTTGACTATCATGAAACATCTAAGCAAAACTATGCGGAACCTAAATGTGTGT
TTGAGGTTTAACCCAACTCCAGGGTTTGATAAATACAAATATCGATCTGATGTTGTCTTA
ATTTACCATAAATCTTAAGACATTATGTGTAAACTACAAAGAGAGAGTCGTCTAACTTGT
CCAAGACTAAAAGATTTAACTTTAACACTTTGATGTTTTGATTCTATTGACTAGCTTGTC
CAGTTCTCCGTAGCTACATCGAAGTTTCCCTATTACAGAAGTCACATGGACACAATTGAC
AAGAACATAGGATACACTGTTTGGTACAAAGAGTTACAGAGATACAGATGCGAAAAAGAA
CACCGGTNTCAAGGGCCACATCAATTAAAAGAACGCTTCGCATTGATTCCTTTCCGGGGG
AATAAATAGATGGACCATTTCGTTCTCTTAGGCACGTTCATCATTCGTGTGGTTCGGGAC
CTCAGGTTGGCTGTCCAGTGGCATGTACTGTGCCATTATGGCTCTAATCTCTGAGTCCAT
GTATTGTAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAG
AGTAATTACCAATTTTTTTTCAATTCANAAATGT
Primers used for PCR HM74 - 8474, show primer details
   
Sequence Name 51-K101220-0022-592-E06C-8409
GenBank Accession LN507439 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>51-K101220-0022-592-E06C-8409
GCCATTGGTACTTTCATTGCTGTAAATCCATGAACATAGCAAGTTCATAACAATTTTCCC
AAGTAATCGATACAATTCCAAGACGATATCGGGTTACATAAAACAATGTTTTAAGAGACA
TCTCAGGCAACCAAAACATAAAACATTAATCTTTTGCTTCTAACAGAAATAGCAGAAGGA
TGAATAAAAAGCTTACCCTCAATCTATATTTGTAAACGAGGTATGCACCAGCAGCTGCAA
GTCCCAATGATAACATTATAAGCCAAACGGCCGCCCACGCTGATTTCACTTGTGAACCCG
TCTTGCCTAAATTCCAGACAAAAGAACCAATTTCAGTTGATAAAGAGAGAGAGAACTTTT
CTAAATTCAGAGGCTATTTGTATGCGCGAGTACTCTTTTCGTGTGTGACATACTCGTACA
TGCATATTTATAGAAATCTAGAAATCTTAAGATGATGAAAACTCACTGATGCAAGTGTCA
TGGTCTCTCATGTAGAGAAGGTCCCCGCTACAAGAGCACTCATAGCTTCCCCAGGTGTTC
TTACAGCTACATTCCGGGCACTGACATGCTTTCTTCTCTTTGCACTCATTGATGTCTAGT
GAAGGAAGTATGAAAAATCCTTAAGAAGATGTTTATGAAGTAAGACAAAAAAAATAGGGT
AACCAAAGTTTTGACAGAGGTCTAACCTTCACATTTCTTAACACCGTCTCCTTTAAATCC
TGGAGGACACTCGCATTTCACACTGTCCTTGTCCTGAAGGCATTACCAGTTCAGACAGAA
GTATCTTACTAAACT
   
Sequence Name 51-K101227-0022-592-E06C-HM74
GenBank Accession LN507440 [GenBank]
Sequencing primer gene specific primer, HM74: 5'-CAGGGAGATGTACAATCAACAATG-3'
Sequence (A. th genome BLAST matches underlined)
>51-K101227-0022-592-E06C-HM74
GACATGCGTTCTCTGCTTGTGTGGTTAGTGGTTTCTCCTGCGCCTTGCTTCACTTTTAAG
CGTATAATCTCACAGTTTAGTAAGATACTTCTGTCTGAACTTGTAATGCCTTCAGGACAA
GGACAGTGTGAAATGCGAGTGTCCTCCAGGATTTAAAGGAGACGGTGTTAAGAAATGTGA
AGGTTAGACCTCTGTCAAAACTTTGGTTACCCTATTTTTTTTGTCTTACTTCATAAACAT
CTTCTTAAGGATTTTTCATACTTCCTTCACTAGACATCAATGAGTGCAAAGAGAAGAAAG
CATGTCAGTGCCCGGAATGTAGCTGTAAGAACACCTGGGGAAGCTATGAGTGCTCTTGTA
GCGGGGACCTTCTCTACATGAGAGACCATGACACTTGCATCAGTGAGTTTTCATCATCTT
AAGATTTCTAGATTTCTATAAATATGCATGTACGAGTATGTCACACACGAAAAGAGTACT
CGCGCATACAAATAGCCTCTGAATTTAGAAAAGTTCTCTCTCTCTTTATCAACTGAAATT
GGTTCTTTTGTCTGGAATTTAGGCAAGACGGGTTCACAAGTGAAATCAGCGTGGGCGGCC
GTTTGGCTTATAATGTTATCATTGGGACTTGCAGCTGCTGGTGCATACCTCGTTTACNAA
TATAGATTGAGGGTAAGCTTTTTATTCATCCTTCTGCTATTTCTGTTAGAAGCAAAAGAT
TAATGTTTTATGTTTTGGTTGCCTGAGATGTCTCTTAAAACATTGTTTTATGTAACCCGA
TATCGTCTTGGAATTGTATCGATTACTTGGGAAAATTGTTATGAACTTGCTATGTTCATG
GATTTACAGCAATGAAAGTACCAATGGCTT

Last Updated on 07.07.2016 14:16