Sequences from confirmation amplicon


Confirmation sequences for line 595F02 and hit At5g18110 are shown.
Line ID 595F02
Locus At5g18110 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:5990648
Primers used for PCR HM80 - 8474, show primer details
   
Sequence Name 53-K101220-0022-595-F02C-8409
GenBank Accession LN508089 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>53-K101220-0022-595-F02C-8409
TTCGGACTGAGCCATTTACATTTGCTGATTGGAATTTTAGGGCTTTTGAAAGCACGAACG
CGTGAAGCTCTAATCGAGAAAAAAATGGAGGTTTTGGATAGGAGAGACGATGAGATCAGG
GACTCGGGAAACATGGACAGCATCAAGTCACACTATGTTACCGACTCTGTTTCCGAGGAA
CGCCGCTCTCGTGAGCTCAAGGATGGAGACCATCCTTTACGGGTTTGTCCTTTATCCTTA
GTATCGATTCATTTGCAATTTGAATCTGATCTTAGCTGAAAATTTGATTCCCGTTCGTCA
AAGATTTCTGAACTTTGTATATGACGGTTTATAGCTAGAGTAGTGGAAGATTCGGATTCT
AAATCTTTGTTTGTTGGAGTTTTTGTTTTCAAATTAGGTTTTGCGAATTTGTTTAGATGT
ATGTGAGCTCAAATGTTATAGGATTTTCGTATTGGTGGTATTGATTGTAGCTAGAACAAG
GCAGATGAATTTAGA
   
Sequence Name 53-K101227-0022-595-F02C-HM80
GenBank Accession LN508090 [GenBank]
Sequencing primer gene specific primer, HM80: 5'-CCTCTAAATCAATCTGCCTTGTTC-3'
Sequence (A. th genome BLAST matches underlined)
>53-K101227-0022-595-F02C-HM80
TCCTATACATTTGAGCTCACATACATCTAACAAATTCGCAAAACCTAATTTGAAAACAAA
AACTCCAACAAACAAAGATTTAGAATCCGAATCTTCCACTACTCTAGCTATAAACCGTCA
TATACAAAGTTCAGAAATCTTTGACGAACGGGAATCAAATTTTCAGCTAAGATCAGATTC
AAATTGCAAATGAATCGATACTAAGGATAAAGGACAAACCCGTAAAGGATGGTCTCCATC
CTTGAGCTCACGAGAGCGGCGTTCCTCGGAAACAGAGTCGGTAACATAGTGTGACTTGAT
GCTGTCCATGTTTCCCGAGTCCCTGATCTCATCGTCTCTCCTATCCNAAACCTCCATTTT
TTTCTCGATTAGAGCTTCACGCGTTCGTGCTTTCAAAAGCCCTAAAATTCCAATCAGCAA
ATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAA
TATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCANAAATGTAGA

Last Updated on 07.07.2016 14:16