Sequences from confirmation amplicon


Confirmation sequences for line 604D02 and hit At2g33710 are shown.
Line ID 604D02
Locus At2g33710 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:14259772
Primers used for PCR NR63 - 8474, show primer details
   
Sequence Name 81-K102508-0022-604-D02C-8409
GenBank Accession LN514054 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>81-K102508-0022-604-D02C-8409
CCATTTACAATTGAATCGGTAGTTCACTCTTGTCATGAAAATGGTGACTTAAATGTGACG
TGCATGTCTATGAATATAACGTATACTATCGGTGTAGAGGCATTTCGTAAAGATTATTAA
AGGGCGTTTGAATCATATGATATGATCATTCTACATCAACTTTTATTCCCCTCTTCTACA
TCTACTTATGAAATCTATATATTAGGCCAAACCTACATTTATACATTCCTCTCTCTCGTA
ATTGGTAATTAACTATATATATACTTATGTATCACACCAATGATATAATTAGGATATAAA
TTAAGTTTGATCATTTTAAATACGTTTTCCCCATGTTACAATCCTAAAACTCTCTCTGGC
TAGTTATCTCAACCAAAATACGACCATTGCAACCAAGCCTTGCCAATCATATTTGTCCGA
AAGCCAAATATGATCAATTTTGTCCAACCAATAAAGCCGACAGGTTTTTTCAAGAAAATC
TAACCATGAACATTCATTAAAAAAATCATATAGTAAATTGAACTAATGCATTGTGGCCAT
ACATGAAATTATATCTCTATTTGATCAAGGCCATGCTGCAGCCACTAAAGGATTACCAAT
TGCAAAATCCAAGATTAAATCATTCCTATGTGTAAAGAGAATCACCAATGGAAAAGA
   
Sequence Name 81-K102509-0022-604-D02C-NR63
GenBank Accession LN514055 [GenBank]
Sequencing primer gene specific primer, NR63: 5'-AACTCGAGTGATTGTCTTTTCCAT-3'
Sequence (A. th genome BLAST matches underlined)
>81-K102509-0022-604-D02C-NR63
ATTTATCTTGGATTTTGCAATTGGTAATCCTTTAGTGGCTGCACCATGGCCTTGATCAAA
TAGAGATATAATTTCATGTATGGCCACAATGCATTAGTTCAATTTACTATATGATTTTTT
TAATGAATGTTCATGGTTAGATTTTCTTGAAAAAACCTGTCGGCTTTATTGGTTGGACAA
AATTGATCATATTTGGCTTTCGGACAAATATGATTGGCAAGGCTTGGTTGCAATGGTCGT
ATTTTGGTTGAGATAACTAGCCAGAGAGAGTTTTAGGATTGTAACATGGGGAAAACGTAT
TTAAAATGATCAAACTTAATTTATATCCTAATTATATCATTGGTGTGATACATAAGTATA
TATATAGTTAATTACCAATTACGAGAGAGAGGAATGTATAAATGTAGGTTTGGCCTAATA
TATAGATTTCATAAGTAGATGTAGAAGAGGGGAATAAAAGTTGATGTAGAATGATCATAT
CATATGATTCAAACGCCCTTTAATAATCTTTACGAAATGCCTCTACACCGATNGTATACG
TTATATTCATAGACATGCACGTCACATTTAAGTCACCATTTTCATGACAAGAGTGAACTA
CCGATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATG
ATGGTCAATATGGAGAANAAGAAAGAGTAATTACCAATTTTTTTT

Last Updated on 07.07.2016 14:16