Sequences from confirmation amplicon


Confirmation sequences for line 620A10 and hit At4g00050 are shown.
Line ID 620A10
Locus At4g00050 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:17809
Primers used for PCR TY01 - 8474, show primer details
   
Sequence Name 19-K026134-022-620-A10C-8409
GenBank Accession LN494605 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>19-K026134-022-620-A10C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCATGAAGATCTCAATAACACA
AAACCTTTTAAACTAGTAAAATACACAGATTTTAGGATGAGCCAATGTGTTCCAAACTGT
CACATCGATGATACTCCGGCAGCAGCCACCACCACCGTCCGCTCCACCACAGCCGCAGAC
ATCCCCATGTACATACCTTAATTTATCATCTTGATAGTATAAGTGGCCACAATATAATGA
TAGCTTTTCTTGTTTGTCTACAGATTAGACTACGAGGTAGCCGAGCTGACGTGGGAGAAC
GGGCAACTAGGCTTGCACGGCTTAGGTCCACCGCGAGTGACGGCTTCGTCGACCAAGTAC
TCCACAGGCGCCGGTGGAACGTTGGAGTCGATAGTGGAC
   
Sequence Name 20-K026134-022-620-A10C-TY01
GenBank Accession LN495059 [GenBank]
Sequencing primer gene specific primer, TY01: 5'-GAGTAGCTTGGTCCACTATCGACT-3'
Sequence (A. th genome BLAST matches underlined)
>20-K026134-022-620-A10C-TY01
CCAACGTTCACCGGCGCCTGTGGAGTACTTGGTCGACGAAGCCGTCACTCGCGGTGGACC
TAAGCCGTGCAAGCCTAGTTGCCCGTTCTCCCACGTCAGCTCGGCTACCTCGTAGTCTAA
TCTGTAGACAAACAAGAAAAGCTATCATTATATTGTGGCCACTTATACTATCAAGATGAT
AAATTAAGGTATGTACATGGGGATGTCTGCGGCTGTGGTGGAGCGGACGGTGGTGGTGGC
TGCTGCCGGAGTATCATCGATGTGACAGTTTGGAACACATTGGCTCATCCTAAAATCTGT
GTATTTTACTAGTTTAAAAGGTTTTGTGTTATTGAGATCTTCATGATATATTCAATTGTA
AATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGA
GAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGT
TATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAG
GCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATT

Last Updated on 23.10.2014 13:25