Sequences from confirmation amplicon


Confirmation sequences for line 620G05 and hit At3g53240 are shown.
Line ID 620G05
Locus At3g53240 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:19738993
Primers used for PCR RE52 - 8474, show primer details
   
Sequence Name 05-K026864-022-620-G05C-8409
GenBank Accession LN488206 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K026864-022-620-G05C-8409
CTGCCTTGTTGATACTTTTATCGACCGTCGTAAAAGATGTACTGGGAGTTATCTAGAGAG
GGTTCGTGGACGTGGAGGATGAAACAATAAAATGTAATAGTTGAATCTTGCAAATATTTT
GATCATATTGTCAAATTTCTCCATCGTATAAAACTTTCGTGAAGATTAACATATCAAATA
TTTTGATCATAAGCTTTCAATATTAAGAGAAGCTGAAACCTTTAGTAAGAAAAATGATTA
CAGGAATCTACAATAATAATTGAAAACGAATATTTATCTTTTTGTTTCGAATTAACGCAA
ATATTTGGTTTATGGACAAACGAATTATAAATTGAAACCGAGAGTAATAATATCTTGAAT
TCTCAAACTCATTATTTTAAAACTATAATGGTCCGACCAGCGAGTTCACCGTCTATACTT
CCTACATATAAATAAATAATTATTAGAACCATGCATGAGAAAAAGAATGTGA
   
Sequence Name 06-K026864-022-620-G05C-RE52
GenBank Accession LN488657 [GenBank]
Sequencing primer gene specific primer, RE52: 5'-GGAGGCAGTAGTCACATTCTTTTT-3'
Sequence (A. th genome BLAST matches underlined)
>06-K026864-022-620-G05C-RE52
TGCATGGTTCTAATAATTATTTATTTATATGTAGGAAGTATAGACGGTGAACTCGCTGGT
CGGACCATTATAGTTTTAAAATAATGAGTTTGAGAATTCAAGATATTATTACTCTCGGTT
TCAATTTATAATTCGTTTGTCCATAAACCAAATATTTGCGTTAATTCGAAACAAAAAGAT
AAATATTCGTTTTCAATTATTATTGTAGATTCCTGTAATCATTTTTCTTACTAAAGGTTT
CAGCTTCTCTTAATATTGAAAGCTTATGATCAAAATATTTGATATGTTAATCTTCACGAA
AGTTTTATACGATGGAGAAATTTGACAATATGATCAAAATATTTGCAAGATTCAACTATT
ACATTTTATTGTTTCATCCTCCACGTCCACGAACCCTCTCTAGATAACTCCCAGTACATC
TTTTACGCGGTCGATAAAAGTATCAACAAGGCAGAACCATGCTCGGGAAATCTACATGGA
TCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTT
CAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAA

Last Updated on 07.07.2016 14:16