Sequences from confirmation amplicon


Confirmation sequences for line 625G11 and hit At4g39570 are shown.
Line ID 625G11
Locus At4g39570 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:18384804
Primers used for PCR NG68 - 8474, show primer details
   
Sequence Name 59-K102368-0022-625-G11C-8409
GenBank Accession LN509959 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>59-K102368-0022-625-G11C-8409
CATTTACATTGAATATATCCTGGTTTAATCGACACCTCCAGCTACACCATAGAAGTGTTC
GACATAAAGACCCAAATTTGGGATCATAGGCCCATCCCTTACTGGGAGAAAGACTGGGGC
GCTCTATCAAGAAGCGCGTATGTTGATGGAAAGTTCTACTTGACGATTGGGATGAAGGTT
ATGGCTTATGATCTAGAGGAAAGTAGATGGGACTTTGCTGGATATCAGATGGGTCAGAGT
TGGTTTTGGTCTTGTAATTGTGTTATAGAGAATGTTTTGTACTGTTATGGTGATGCTTTC
CGATGGTTTGACACTAAGCTGAGATTGTGGAAAGTTATGAAGGTGAAAGGACTACCTAAG
TTGTCCCGTAATGTCGAANTTAAGA
   
Sequence Name 59-K102369-0022-625-G11C-NG68
GenBank Accession LN509960 [GenBank]
Sequencing primer gene specific primer, NG68: 5'-ATCTTAACATCGACATTACGGGAC-3'
Sequence (A. th genome BLAST matches underlined)
>59-K102369-0022-625-G11C-NG68
CTTTCCCATCTCAGCTTAGTGTCAACCATCGGAAAGCATCACCATAACAGTACAAAACAT
TCTCTATAACACAATTACAAGACCAAAACCAACTCTGACCCATCTGATATCCAGCAAAGT
CCCATCTACTTTCCTCTAGATCATAAGCCATAACCTTCATCCCAATCGTCAAGTAGAACT
TTCCATCAACATACGCGCTTCTTGATAGAGCGCCCCAGTCTTTCTCCCAGTAAGGGATGG
GCCTATGATCCCAAATTTGGGTCTTTATGTCGAACACTTCTATGGTGTAGCTGGAGGTGT
CGATTGAAACAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGAT
CAGCAATGAGTATGATGGTCAATATA
Primers used for PCR NG69 - 8474, show primer details
   
Sequence Name 60-K102368-0022-625-G11C-OriL
GenBank Accession LN510219 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>60-K102368-0022-625-G11C-OriL
TTACATTGCTGAAAGGAATCTGCATCATCACCGTCGACACCTCCAGCTACATAAATCTTT
CCATCAATAACACTAGCAGCAGGGTCCGACCTTTCCATCTGCAGGCTTGGAGCCTCACGC
AACGTGTGAGACCGGCAGTCTAGGATCACGACTCTAGAGGAACGCACATTCTCCTCCATG
TATCCGCCAAAGAAGTAGATATCGGAACCAACAGACGCGTGACCTGACCAGTGCTCAAGA
GGGGGATTAGGAACTGGAATTGGGATCAAAAGATTACCACTTGACATCTTCTTCTTCTTC
TTCTTCTTGCCATTTTTTAGGGTTCTGTCAGGTTTCATGCAGAGAGTGAACCAGAGAGGG
TTCGGATCAGGATTTCCCTCCTGTAAACACAAATACAGACAACTCTCGGTTCGGCCTAAT
AGTGACCGTGTCTCGTAAAGCTCCGGTGAACGGAGGAGAGATCTAAAGCTCTTGGAGACA
AGAGAGAGAATCGGATAATACAATCTGGAGACTCGTGCGAAGATACTTACAAGCAAATCA
TCAGGAAGTG
   
Sequence Name 60-K102369-0022-625-G11C-NG69
GenBank Accession LN510220 [GenBank]
Sequencing primer gene specific primer, NG69: 5'-CACTTCCTGATGATTTGCTTGTAA-3'
Sequence (A. th genome BLAST matches underlined)
>60-K102369-0022-625-G11C-NG69
CCGATTCTCTCTCTTGTCTCAAGAGCTTTAGATCTCTCCTCCGTTCACCGGAGCTTTACG
AGACACGGTCACTATTAGGCCGAACCGAGAGTTGTCTGTATTTGTGTTTACAGGAGGGAA
ATCCTGATCCGAACCCTCTCTGGTTCACTCTCTGCATGAAACCTGACAGAACCCTAAAAA
ATGGCAAGAAGAAGAAGAAGAAGAAGATGTCAAGTGGTAATCTTTTGATCCCAATTCCAG
TTCCTAATCCCCCTCTTGAGCACTGGTCAGGTCACGCGTCTGTTGGTTCCGATATCTACT
TCTTTGGCGGATACATGGAGGAGAATGTGCGTTCCTCTAGAGTCGTGATCCTAGACTGCC
GGTCTCACACGTTGCGTGAGGCTCCAAGCCTGCAGATGGAAAGGTCGGACCCTGCTGCTA
GTGTTATTGATGGAAAGATTTATGTAGCTGGAGGTGTCGACGGTGATGATGCAGATTCCT
TTCAGCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGA
GGATCAATATA

Last Updated on 23.10.2014 13:25