Sequences from confirmation amplicon


Confirmation sequences for line 627C09 and hit At5g59780 are shown.
Line ID 627C09
Locus At5g59780 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:24082771
Primers used for PCR KH05 - 8474, show primer details
   
Sequence Name 11-K025673-022-627-C09C-8409
GenBank Accession LN490950 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>11-K025673-022-627-C09C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGGCCTCAAACCCGGAC
ATGCAAGCTACTTCCTCATCTTCAAACTGTTGCTCATCATCTATGACCACTACTACTAGT
CAAGACACTGGAGGCTCCAACGGGAAAATGAATCAAGAATGCGAAGACGGGTACTACTCC
ATGGATGACATATGGAGAGAGATTGATCAGTCTGGAGCAAACGTTATTAAACCGGTAAAA
GACAACTACTACTCAGAGCAAAGCTGTTACTTGAATTTCCCTCCTCTGGCTTCTCCAACA
TGGGAAAGTTCCTTGGAATCTATATGGAACATGGATGCAGATGAAAGTAAGATGTCTTCT
TTTGCTATTGATCAGTTTCCTCTAAGTTTTGAACATGGTAGTGGTCGCCTTTAGTCT
   
Sequence Name 12-K025673-022-627-C09C-KH05
GenBank Accession LN491409 [GenBank]
Sequencing primer gene specific primer, KH05: 5'-TAGACTAAAGGCGACCACTACCAT-3'
Sequence (A. th genome BLAST matches underlined)
>12-K025673-022-627-C09C-KH02
ACTTAGAGGAAACTGATCAATAGCAAAAGAAGACATCTTACTTTCATCTGCATCCATGTT
CCATATAGATTCCAAGGAACTTTCCCATGTTGGAGAAGCCAGAGGAGGGAAATTCAAGTA
ACAGCTTTGCTCTGAGTAGTAGTTGTCTTTTACCGGTTTAATAACGTTTGCTCCAGACTG
ATCAATCTCTCTCCATATGTCATCCATGGAGTAGTACCCGTCTTCGCATTCTTGATTCAT
TTTCCCGTTGGAGCCTCCAGTGTCTTGACTAGTAGTAGTGGTCATAGATGATGAGCAACA
GTTTGAAGATGAGGAAGTAGCTTGCATGTCCGGGTTTGAGGCCAGGATATATTCAATTGT
AAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGG
AGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCG
TTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATA
GGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCT

Last Updated on 23.10.2014 13:25