Sequences from confirmation amplicon


Confirmation sequences for line 634G07 and hit At3g62380 are shown.
Line ID 634G07
Locus At3g62380 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:23084155
Primers used for PCR NG64 - 8474, show primer details
   
Sequence Name 64-K102368-0022-634-G07C-8409
GenBank Accession LN511166 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>64-K102368-0022-634-G07C-8409
TTACATTGAATAAATACATCAAGATTACTTTGTATGTTCCTGTAACCATGTCTCTTCCAA
ATCCCACATTAATTGGCAAATCATTCGACCAACCTAAAGAAAAAAAAATAGACATTAAAG
TACTATAACAACTAGTCAACGTCTATACTTTTTGGTAATTCTTCTATGCATATAAATTAA
TATAGCCCTTTATAAAATTGAAAAGTACTTAAATATATATATATACTTAATTTACTTTGT
AATTTATATTTATAATTTTTTTATTTTTTTTGTGAAACAATTTATTTATAATAGATATAT
TGTATATTGTATATTGTATATAATCAGCATAAAAATCTAGAAATAAAAGTGTTTCATACC
AGTGCGGCCTGTATACTCTCGCAAAAACTCGGGAGAAAGAATCCGGAGTTTTCTCGTTGC
GGGGTTAATCAGATAAATGTAACCGAGATCGTAGATGCAGACTATTCCGTTGCAATACCC
CATTATTTGACCAACTGTATCATAAGTAGAATATTTGGGATATGGAACTGGAGATGTGTA
AGAATGAATAAAGATGTTTATGT
   
Sequence Name 64-K102369-0022-634-G07C-NG64
GenBank Accession LN511167 [GenBank]
Sequencing primer gene specific primer, NG64: 5'-GATCATCACGACCACATAAACATC-3'
Sequence (A. th genome BLAST matches underlined)
>64-K102369-0022-634-G07C-NG64
TCTCAGTTCATATCCCAATATTCTACTTATGATACAGTTGGTCAAATAATGGGGTATTGC
AACGGAATAGTCTGCATCTACGATCTCGGTTACATTTATCTGATTAACCCCGCAACGAGA
AAACTCCGGATTCTTTCTCCCGAGTTTTTGCGAGAGTATACAGGCCGCACTGGTATGAAA
CACTTTTATTTCTAGATTTTTATGCTGATTATATACAATATACAATATACAATATATCTA
TTATAAATAAATTGTTTCACAAAAAAAATAAAAAAATTATAAATATAAATTACAAAGTAA
ATTAAGTATATATATATATTTAAGTACTTTTCAATTTTATAAAGGGCTATATTAATTTAT
ATGCATAGAAGAATTACCAAAAAGTATAGACGTTGACTAGTTGTTATAGTACTTTAATGT
CTATTTTTTTTTCTTTAGGTTGGTCGAATGATTTGCCAATTAATGTGGGATTTGGAAGAG
ACATGGTTACAGGAACATACAAAGTAATCTTGATGTATTTATTCAATTGTAAATGGCTTC
ATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGAGGTTCAAT

Last Updated on 07.07.2016 14:16